Incidental Mutation 'R7133:Cct7'
ID552815
Institutional Source Beutler Lab
Gene Symbol Cct7
Ensembl Gene ENSMUSG00000030007
Gene Namechaperonin containing Tcp1, subunit 7 (eta)
SynonymsCctz, Ccth
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location85451514-85468475 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85466645 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 332 (T332A)
Ref Sequence ENSEMBL: ENSMUSP00000032078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032078] [ENSMUST00000159062] [ENSMUST00000161078] [ENSMUST00000161546] [ENSMUST00000204489] [ENSMUST00000204592]
Predicted Effect probably benign
Transcript: ENSMUST00000032078
AA Change: T332A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000032078
Gene: ENSMUSG00000030007
AA Change: T332A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 524 1.8e-163 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159062
SMART Domains Protein: ENSMUSP00000125671
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161078
SMART Domains Protein: ENSMUSP00000124524
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
Pfam:F-box 536 592 4.8e-5 PFAM
Pfam:F-box-like 554 593 9e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161546
SMART Domains Protein: ENSMUSP00000124754
Gene: ENSMUSG00000047013

DomainStartEndE-ValueType
ZnF_C2H2 8 33 5.81e-2 SMART
low complexity region 65 77 N/A INTRINSIC
low complexity region 100 122 N/A INTRINSIC
low complexity region 162 192 N/A INTRINSIC
SCOP:d1eq1a_ 197 340 2e-5 SMART
low complexity region 352 374 N/A INTRINSIC
low complexity region 425 440 N/A INTRINSIC
low complexity region 519 540 N/A INTRINSIC
Pfam:F-box-like 554 593 5.6e-10 PFAM
low complexity region 745 759 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204489
SMART Domains Protein: ENSMUSP00000144919
Gene: ENSMUSG00000030007

DomainStartEndE-ValueType
PDB:4B2T|H 1 53 2e-29 PDB
Blast:VWA 5 51 4e-7 BLAST
SCOP:d1a6da1 16 51 2e-8 SMART
low complexity region 68 80 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204592
AA Change: T290A

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144893
Gene: ENSMUSG00000030007
AA Change: T290A

DomainStartEndE-ValueType
Pfam:Cpn60_TCP1 32 91 6e-21 PFAM
Pfam:Cpn60_TCP1 88 482 5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204612
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 5 and 6. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Cct7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02223:Cct7 APN 6 85462041 missense probably benign 0.00
IGL02292:Cct7 APN 6 85461109 missense probably benign 0.03
IGL02724:Cct7 APN 6 85459149 missense probably damaging 1.00
IGL02740:Cct7 APN 6 85468270 missense probably benign
PIT4495001:Cct7 UTSW 6 85459961 missense probably damaging 1.00
R0184:Cct7 UTSW 6 85461554 missense probably null 0.55
R1363:Cct7 UTSW 6 85466035 missense probably damaging 1.00
R1378:Cct7 UTSW 6 85467563 intron probably null
R2076:Cct7 UTSW 6 85468140 missense probably damaging 0.98
R2210:Cct7 UTSW 6 85459230 missense probably damaging 1.00
R3905:Cct7 UTSW 6 85466708 missense possibly damaging 0.90
R4298:Cct7 UTSW 6 85468173 missense probably damaging 1.00
R4422:Cct7 UTSW 6 85467145 missense probably damaging 0.98
R6519:Cct7 UTSW 6 85462150 missense probably benign 0.19
R6903:Cct7 UTSW 6 85466693 missense probably benign 0.27
R6925:Cct7 UTSW 6 85459182 missense probably damaging 1.00
R7458:Cct7 UTSW 6 85459996 missense probably benign 0.14
Z1177:Cct7 UTSW 6 85466669 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACGAGACCCTTTGCCTTGTG -3'
(R):5'- ATCGGAGCCAAGATCCAACTAG -3'

Sequencing Primer
(F):5'- GAGACCCTTTGCCTTGTGTTTGTTC -3'
(R):5'- GGAGCCAAGATCCAACTAGAACTTC -3'
Posted On2019-05-15