Incidental Mutation 'R7133:Syne1'
ID552833
Institutional Source Beutler Lab
Gene Symbol Syne1
Ensembl Gene ENSMUSG00000096054
Gene Namespectrin repeat containing, nuclear envelope 1
SynonymsA330049M09Rik, enaptin165, SYNE-1, nesprin-1, C130039F11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location5020917-5551482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5231592 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 4248 (W4248R)
Ref Sequence ENSEMBL: ENSMUSP00000150262 (fasta)
Predicted Effect probably damaging
Transcript: ENSMUST00000215295
AA Change: W4248R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a spectrin repeat containing protein expressed in skeletal and smooth muscle, and peripheral blood lymphocytes, that localizes to the nuclear membrane. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia 8, also referred to as autosomal recessive cerebellar ataxia type 1 or recessive ataxia of Beauce. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an allele lacking the KASH domain exhibit neonatal and postnatal lethality, progressive muscular dystrophy, and limb weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Syne1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Syne1 APN 10 5342167 synonymous probably benign
IGL00725:Syne1 APN 10 5344922 missense possibly damaging 0.48
IGL00799:Syne1 APN 10 5347878 missense probably benign 0.00
IGL01087:Syne1 APN 10 5425708 missense probably damaging 1.00
IGL01123:Syne1 APN 10 5344921 nonsense probably null
IGL01147:Syne1 APN 10 5052691 nonsense probably null
IGL01150:Syne1 APN 10 5443154 missense probably damaging 1.00
IGL01154:Syne1 APN 10 5360848 missense probably damaging 1.00
IGL01727:Syne1 APN 10 5047842 missense probably damaging 0.99
IGL01761:Syne1 APN 10 5405456 missense probably damaging 1.00
IGL01793:Syne1 APN 10 5352191 missense possibly damaging 0.67
IGL01961:Syne1 APN 10 5043723 missense possibly damaging 0.94
IGL01975:Syne1 APN 10 5068908 intron probably benign
IGL02152:Syne1 APN 10 5424382 missense probably damaging 1.00
IGL02423:Syne1 APN 10 5368295 missense probably benign 0.00
IGL02457:Syne1 APN 10 5342167 missense probably damaging 1.00
IGL02543:Syne1 APN 10 5043618 missense probably damaging 0.97
IGL02836:Syne1 APN 10 5409875 splice site probably benign
IGL03141:Syne1 APN 10 5424261 missense probably damaging 1.00
FR4548:Syne1 UTSW 10 5032969 missense probably benign 0.09
IGL02799:Syne1 UTSW 10 5359059 missense probably damaging 1.00
PIT4305001:Syne1 UTSW 10 5333023 missense probably damaging 1.00
PIT4687001:Syne1 UTSW 10 5358390 missense possibly damaging 0.87
R0004:Syne1 UTSW 10 5443132 splice site probably benign
R0110:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0165:Syne1 UTSW 10 5033096 missense probably benign 0.28
R0194:Syne1 UTSW 10 5424311 missense probably benign
R0311:Syne1 UTSW 10 5348943 missense possibly damaging 0.92
R0328:Syne1 UTSW 10 5348945 missense possibly damaging 0.62
R0379:Syne1 UTSW 10 5541989 missense probably damaging 1.00
R0387:Syne1 UTSW 10 5351029 missense probably benign
R0452:Syne1 UTSW 10 5405435 missense probably damaging 0.98
R0456:Syne1 UTSW 10 5342252 missense probably benign 0.04
R0457:Syne1 UTSW 10 5022041 missense probably damaging 1.00
R0469:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0510:Syne1 UTSW 10 5367600 missense probably damaging 1.00
R0533:Syne1 UTSW 10 5358438 missense probably benign 0.00
R0617:Syne1 UTSW 10 5350933 missense probably damaging 1.00
R0690:Syne1 UTSW 10 5033138 splice site probably benign
R0964:Syne1 UTSW 10 5043652 missense possibly damaging 0.95
R1133:Syne1 UTSW 10 5349044 missense possibly damaging 0.77
R1327:Syne1 UTSW 10 5048925 splice site probably benign
R1339:Syne1 UTSW 10 5367571 missense probably damaging 1.00
R1531:Syne1 UTSW 10 5347875 nonsense probably null
R1558:Syne1 UTSW 10 5349280 nonsense probably null
R1633:Syne1 UTSW 10 5349388 missense probably damaging 1.00
R1642:Syne1 UTSW 10 5348694 missense possibly damaging 0.94
R1658:Syne1 UTSW 10 5367616 missense probably benign 0.03
R1753:Syne1 UTSW 10 5367621 missense probably benign 0.28
R1759:Syne1 UTSW 10 5349369 missense probably damaging 1.00
R1792:Syne1 UTSW 10 5040975 missense probably damaging 1.00
R2076:Syne1 UTSW 10 5040897 missense probably damaging 0.99
R2079:Syne1 UTSW 10 5361502 missense probably benign 0.01
R2102:Syne1 UTSW 10 5056514 missense probably damaging 1.00
R2233:Syne1 UTSW 10 5041484 missense probably benign 0.01
R2305:Syne1 UTSW 10 5047573 missense probably damaging 0.97
R3435:Syne1 UTSW 10 5348565 missense probably damaging 1.00
R3749:Syne1 UTSW 10 5052267 splice site probably benign
R3876:Syne1 UTSW 10 5052345 missense possibly damaging 0.57
R3895:Syne1 UTSW 10 5405456 missense probably damaging 0.98
R3974:Syne1 UTSW 10 5043630 missense probably benign 0.06
R4042:Syne1 UTSW 10 5041584 missense probably benign 0.21
R4120:Syne1 UTSW 10 5409798 missense probably damaging 1.00
R4201:Syne1 UTSW 10 5347870 missense probably benign
R4364:Syne1 UTSW 10 5353987 missense probably damaging 0.96
R4498:Syne1 UTSW 10 5031768 missense probably benign 0.00
R4767:Syne1 UTSW 10 5344866 nonsense probably null
R4804:Syne1 UTSW 10 5349310 missense possibly damaging 0.95
R4917:Syne1 UTSW 10 5057909 missense probably damaging 1.00
R4930:Syne1 UTSW 10 5052777 missense probably damaging 0.99
R5081:Syne1 UTSW 10 5047767 missense probably benign 0.04
R5089:Syne1 UTSW 10 5405444 nonsense probably null
R5174:Syne1 UTSW 10 5041490 missense probably damaging 0.99
R5205:Syne1 UTSW 10 5052295 missense probably benign 0.05
R5303:Syne1 UTSW 10 5420464 missense probably benign 0.00
R5384:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5385:Syne1 UTSW 10 5041494 missense probably benign 0.00
R5392:Syne1 UTSW 10 5348661 missense probably damaging 1.00
R5442:Syne1 UTSW 10 5343473 missense probably benign 0.09
R5750:Syne1 UTSW 10 5339209 missense probably benign 0.01
R5935:Syne1 UTSW 10 5360706 unclassified probably null
R6015:Syne1 UTSW 10 5346819 critical splice donor site probably null
R6023:Syne1 UTSW 10 5443223 missense probably benign 0.09
R6049:Syne1 UTSW 10 5347926 missense possibly damaging 0.79
R6084:Syne1 UTSW 10 5348994 missense probably damaging 1.00
R6145:Syne1 UTSW 10 5052750 missense probably damaging 1.00
R6164:Syne1 UTSW 10 5061429 missense probably damaging 1.00
R6165:Syne1 UTSW 10 5425678 missense probably damaging 1.00
R6198:Syne1 UTSW 10 5302269 missense probably damaging 0.99
R6217:Syne1 UTSW 10 5293761 missense probably benign 0.00
R6247:Syne1 UTSW 10 5349071 missense probably damaging 0.98
R6271:Syne1 UTSW 10 5234652 missense probably damaging 1.00
R6338:Syne1 UTSW 10 5255475 missense probably benign 0.00
R6344:Syne1 UTSW 10 5022212 missense probably benign 0.08
R6434:Syne1 UTSW 10 5318422 missense probably benign 0.01
R6476:Syne1 UTSW 10 5154531 missense possibly damaging 0.88
R6479:Syne1 UTSW 10 5231679 nonsense probably null
R6479:Syne1 UTSW 10 5456826 missense probably damaging 1.00
R6546:Syne1 UTSW 10 5218645 nonsense probably null
R6578:Syne1 UTSW 10 5405454 nonsense probably null
R6611:Syne1 UTSW 10 5045273 missense probably benign 0.01
R6615:Syne1 UTSW 10 5301340 missense probably damaging 0.98
R6632:Syne1 UTSW 10 5215667 critical splice donor site probably null
R6662:Syne1 UTSW 10 5128416 missense probably damaging 1.00
R6677:Syne1 UTSW 10 5040942 missense possibly damaging 0.82
R6764:Syne1 UTSW 10 5229011 nonsense probably null
R6765:Syne1 UTSW 10 5143285 intron probably null
R6778:Syne1 UTSW 10 5102406 missense probably damaging 0.97
R6851:Syne1 UTSW 10 5262703 nonsense probably null
R6878:Syne1 UTSW 10 5420388 missense possibly damaging 0.78
R6883:Syne1 UTSW 10 5231704 nonsense probably null
R6910:Syne1 UTSW 10 5048887 missense probably benign 0.01
R6916:Syne1 UTSW 10 5227912 missense probably benign 0.00
R6925:Syne1 UTSW 10 5126682 missense probably benign 0.00
R6943:Syne1 UTSW 10 5083940 missense probably benign
R6947:Syne1 UTSW 10 5175789 missense probably damaging 1.00
R6965:Syne1 UTSW 10 5229120 missense possibly damaging 0.66
R6968:Syne1 UTSW 10 5117041 missense probably benign 0.09
R7043:Syne1 UTSW 10 5072193 missense possibly damaging 0.77
R7059:Syne1 UTSW 10 5346859 missense probably damaging 1.00
R7067:Syne1 UTSW 10 5234586 missense probably damaging 1.00
R7087:Syne1 UTSW 10 5542024 start gained probably benign
R7099:Syne1 UTSW 10 5123744 missense probably benign 0.43
R7107:Syne1 UTSW 10 5132078 missense probably damaging 1.00
R7120:Syne1 UTSW 10 5293971 missense probably benign
R7127:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7128:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7131:Syne1 UTSW 10 5228221 missense probably damaging 1.00
R7132:Syne1 UTSW 10 5243180 missense probably damaging 1.00
R7135:Syne1 UTSW 10 5233409 missense probably benign 0.01
R7147:Syne1 UTSW 10 5249340 missense probably damaging 1.00
R7158:Syne1 UTSW 10 5057931 missense probably damaging 1.00
R7189:Syne1 UTSW 10 5424295 missense probably benign 0.03
R7193:Syne1 UTSW 10 5233406 missense probably damaging 1.00
R7194:Syne1 UTSW 10 5110859 missense probably damaging 1.00
R7233:Syne1 UTSW 10 5302160 missense probably damaging 1.00
R7255:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7267:Syne1 UTSW 10 5228218 missense probably damaging 1.00
R7294:Syne1 UTSW 10 5097483 critical splice donor site probably null
R7303:Syne1 UTSW 10 5256805 missense probably benign 0.04
R7313:Syne1 UTSW 10 5047635 missense probably damaging 1.00
R7330:Syne1 UTSW 10 5128434 missense probably benign 0.00
R7334:Syne1 UTSW 10 5057886 missense probably damaging 1.00
R7363:Syne1 UTSW 10 5140970 missense possibly damaging 0.45
R7400:Syne1 UTSW 10 5218580 missense probably benign 0.12
R7425:Syne1 UTSW 10 5425760 missense probably damaging 1.00
R7427:Syne1 UTSW 10 5273718 missense probably damaging 0.98
R7446:Syne1 UTSW 10 5222266 missense probably benign 0.00
R7462:Syne1 UTSW 10 5052793 missense possibly damaging 0.87
R7502:Syne1 UTSW 10 5333446 missense probably damaging 0.98
R7525:Syne1 UTSW 10 5185559 critical splice acceptor site probably null
R7529:Syne1 UTSW 10 5424382 missense probably damaging 1.00
R7577:Syne1 UTSW 10 5124820 missense probably damaging 1.00
R7579:Syne1 UTSW 10 5349324 missense probably damaging 1.00
R7594:Syne1 UTSW 10 5215190 critical splice donor site probably null
R7646:Syne1 UTSW 10 5172949 missense probably damaging 1.00
R7651:Syne1 UTSW 10 5205074 missense probably benign 0.38
R7651:Syne1 UTSW 10 5343416 missense probably damaging 1.00
R7669:Syne1 UTSW 10 5061531 missense probably damaging 1.00
R7672:Syne1 UTSW 10 5218527 missense probably benign 0.02
R7682:Syne1 UTSW 10 5162461 missense probably benign
R7702:Syne1 UTSW 10 5245835 missense probably damaging 1.00
R7767:Syne1 UTSW 10 5333560 missense possibly damaging 0.60
R7767:Syne1 UTSW 10 5333632 missense possibly damaging 0.49
R7829:Syne1 UTSW 10 5342293 missense probably damaging 0.96
RF010:Syne1 UTSW 10 5246386 missense possibly damaging 0.89
RF015:Syne1 UTSW 10 5302248 missense probably benign 0.01
RF023:Syne1 UTSW 10 5255482 missense probably damaging 1.00
X0017:Syne1 UTSW 10 5346917 missense probably damaging 1.00
X0025:Syne1 UTSW 10 5358973 nonsense probably null
X0063:Syne1 UTSW 10 5052354 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCACAGACAAACATGTCTCTTTTG -3'
(R):5'- TGTAAGCAGGTCTCTGTGAGC -3'

Sequencing Primer
(F):5'- ACAAACATGTCTCTTTTGCCTATTGG -3'
(R):5'- CAGGTCTCTGTGAGCACCATTG -3'
Posted On2019-05-15