Incidental Mutation 'R7133:St6galnac1'
ID552841
Institutional Source Beutler Lab
Gene Symbol St6galnac1
Ensembl Gene ENSMUSG00000009588
Gene NameST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1
SynonymsSiat7a, ST6GalNAc I
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location116765025-116775507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 116767073 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 334 (T334A)
Ref Sequence ENSEMBL: ENSMUSP00000009732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009732]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009732
AA Change: T334A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000009732
Gene: ENSMUSG00000009588
AA Change: T334A

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Glyco_transf_29 230 518 2.9e-72 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of proteins affects cell-cell interaction, interactions with the matrix, and the functions of intracellular molecules. ST6GALNAC1 transfers a sialic acid, N-acetylneuraminic acid (NeuAc), in an alpha-2,6 linkage to O-linked GalNAc residues. The cancer-associated sialyl-Tn (sTn) antigen is formed by ST6GALNAC1-catalyzed sialylation of GalNAc residues on mucins (Ikehara et al., 1999 [PubMed 10536037]; Sewell et al., 2006 [PubMed 16319059]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in St6galnac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:St6galnac1 APN 11 116767706 missense probably damaging 1.00
IGL01451:St6galnac1 APN 11 116769339 missense probably benign 0.00
IGL01873:St6galnac1 APN 11 116766611 missense probably damaging 0.98
IGL02569:St6galnac1 APN 11 116767702 missense probably damaging 1.00
IGL02799:St6galnac1 APN 11 116766647 splice site probably benign
IGL02935:St6galnac1 APN 11 116769345 missense probably benign
IGL03124:St6galnac1 APN 11 116775299 missense probably benign 0.00
PIT4520001:St6galnac1 UTSW 11 116769349 missense probably benign 0.00
R0126:St6galnac1 UTSW 11 116766584 missense probably benign 0.00
R0363:St6galnac1 UTSW 11 116768930 missense probably benign 0.36
R0394:St6galnac1 UTSW 11 116766640 missense probably damaging 0.99
R0828:St6galnac1 UTSW 11 116768997 missense probably benign 0.05
R1569:St6galnac1 UTSW 11 116769271 missense possibly damaging 0.46
R1570:St6galnac1 UTSW 11 116766648 splice site probably benign
R1591:St6galnac1 UTSW 11 116765863 missense probably damaging 1.00
R1602:St6galnac1 UTSW 11 116769287 missense probably benign 0.00
R2088:St6galnac1 UTSW 11 116769107 missense probably benign 0.00
R2212:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R2266:St6galnac1 UTSW 11 116767847 nonsense probably null
R3413:St6galnac1 UTSW 11 116765856 missense probably damaging 1.00
R3835:St6galnac1 UTSW 11 116766283 missense probably damaging 1.00
R5016:St6galnac1 UTSW 11 116765880 missense probably damaging 1.00
R5446:St6galnac1 UTSW 11 116766269 missense probably benign 0.37
R6625:St6galnac1 UTSW 11 116765891 missense probably damaging 1.00
R6805:St6galnac1 UTSW 11 116768944 missense probably damaging 1.00
R7007:St6galnac1 UTSW 11 116767007 nonsense probably null
R7491:St6galnac1 UTSW 11 116769184 missense probably benign 0.14
R7724:St6galnac1 UTSW 11 116766072 critical splice donor site probably null
R7812:St6galnac1 UTSW 11 116769101 missense probably benign 0.16
R8160:St6galnac1 UTSW 11 116775490 start gained probably benign
R8341:St6galnac1 UTSW 11 116768888 missense probably benign 0.00
R8373:St6galnac1 UTSW 11 116769233 missense possibly damaging 0.62
R8379:St6galnac1 UTSW 11 116775499 start gained probably benign
Z1177:St6galnac1 UTSW 11 116775428 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGCCATGCCCATTCTCAATC -3'
(R):5'- ATATGGGCTATAATGGGCGAC -3'

Sequencing Primer
(F):5'- AATCTTGTTTCTCCCCTGAGCAG -3'
(R):5'- CCTGTGGATCAAGATGTAGCACTC -3'
Posted On2019-05-15