Mutagenetix > Incidental Mutations

Incidental Mutation 'R7133:Trip11'

552845

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

GMAP-210, 3110031G15Rik, 2610511G22Rik, 6030460N08Rik, TRIP230

MMRRC Submission

Accession Numbers

Genbank: NM_028446.1; Ensembl: ENSMUST00000021605, ENSMUST00000085086, ENSMUST00000110038

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7133 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101834043-101913267 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101884070 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 1245 (Q1245L)

Ref Sequence

ENSEMBL: ENSMUSP00000021605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183] [ENSMUST00000177536]

Predicted Effect

probably damaging
Transcript: ENSMUST00000021605
AA Change: Q1245L

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: Q1245L

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000177183
AA Change: Q960L

PolyPhen 2 Score 0.551 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: Q960L

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000177480

Predicted Effect

probably benign
Transcript: ENSMUST00000177536

SMART Domains

Protein: ENSMUSP00000135669
Gene: ENSMUSG00000021188

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	53	129	N/A	INTRINSIC
coiled coil region	166	193	N/A	INTRINSIC
coiled coil region	217	517	N/A	INTRINSIC

Meta Mutation Damage Score

0.0652

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

98% (91/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610008E11Rik	T	A	10: 79,066,639	K614N	probably benign	Het
2610008E11Rik	T	G	10: 79,066,640	K614T	probably benign	Het
Ahsa1	T	A	12: 87,270,342	S120R	probably benign	Het
Anapc16	G	A	10: 59,996,480	T37I	possibly damaging	Het
Arid2	C	A	15: 96,378,875	P1606H	probably damaging	Het
Ash1l	TATCTCCTTTTCCAAAAA	TA	3: 88,983,457		probably null	Het
Asic1	T	A	15: 99,672,087	N96K	probably damaging	Het
Asph	A	T	4: 9,484,575	D582E	probably benign	Het
Astn1	A	G	1: 158,572,987	D528G	probably damaging	Het
Atp9b	A	G	18: 80,909,656	V164A		Het
Cbx6	C	T	15: 79,828,665	G187D	possibly damaging	Het
Cct7	A	G	6: 85,466,645	T332A	probably benign	Het
Clca4a	A	T	3: 144,961,890	L440*	probably null	Het
Crybg2	A	T	4: 134,065,443	I130F	probably benign	Het
Crybg3	T	C	16: 59,536,804	E798G	probably damaging	Het
Ctnnd2	A	G	15: 30,480,849	E81G	possibly damaging	Het
Cwc22	C	T	2: 77,929,478	R75H	possibly damaging	Het
Cym	T	G	3: 107,214,214	D254A	probably damaging	Het
D1Ertd622e	G	A	1: 97,645,920	P140L	probably benign	Het
Dcaf11	T	A	14: 55,568,926		probably null	Het
Dctn1	A	T	6: 83,180,044		probably null	Het
Dennd5a	C	T	7: 109,896,242		probably null	Het
Dmpk	T	A	7: 19,087,307	C217S	probably damaging	Het
Dnah1	C	A	14: 31,286,076	V2125L	probably benign	Het
Exoc4	G	A	6: 33,438,473	A427T	probably benign	Het
Farp2	G	T	1: 93,621,234	V1021F	probably damaging	Het
Flg2	T	C	3: 93,219,762	S1994P	unknown	Het
Fmnl1	T	C	11: 103,181,784		probably null	Het
Frem2	T	A	3: 53,572,339	I1978F	possibly damaging	Het
Gan	T	A	8: 117,187,230	C122*	probably null	Het
Gpr25	T	A	1: 136,260,821	Y18F	probably damaging	Het
Hoxa7	C	T	6: 52,215,740	E223K	probably benign	Het
Hypk	A	G	2: 121,453,480		probably null	Het
Ibsp	A	T	5: 104,302,306	K27*	probably null	Het
Ighv6-5	T	A	12: 114,416,775	T41S	probably benign	Het
Ighv9-4	T	C	12: 114,300,137	M59V	probably benign	Het
Il17rb	T	C	14: 29,996,871	D418G	probably damaging	Het
Ints5	T	A	19: 8,895,559	V294E	probably damaging	Het
Irx6	G	A	8: 92,678,413	C303Y	probably damaging	Het
Itih3	T	A	14: 30,917,698	I389F	probably damaging	Het
Lama1	C	T	17: 67,782,146	T1604I		Het
Lama3	C	A	18: 12,539,786	Q873K	probably benign	Het
Lhx1	T	G	11: 84,519,920	S284R	probably benign	Het
Lrba	T	A	3: 86,394,931		probably null	Het
Lrg1	C	T	17: 56,120,592	G127R	possibly damaging	Het
Mapre1	T	A	2: 153,764,963	L205H	probably benign	Het
Meltf	A	G	16: 31,892,799	N581S	probably damaging	Het
Mgat5	A	C	1: 127,365,189	M149L	probably benign	Het
Myh1	A	G	11: 67,202,586	T168A	probably benign	Het
Naalad2	C	T	9: 18,327,377	V681I	probably benign	Het
Olfr584	T	A	7: 103,085,998	L155Q	probably damaging	Het
Olfr78	A	G	7: 102,742,317	S229P	probably damaging	Het
Pcnx2	T	C	8: 125,801,504	T1326A	probably benign	Het
Peg3	A	T	7: 6,708,945	C1093S	probably damaging	Het
Pidd1	T	C	7: 141,439,900	S650G	probably benign	Het
Pik3c2b	T	C	1: 133,090,234	S945P	possibly damaging	Het
Plec	T	C	15: 76,176,027	T3237A	possibly damaging	Het
Prpf3	A	T	3: 95,833,740		probably null	Het
Prpf4b	C	A	13: 34,901,494	H974Q	probably benign	Het
Ptpn3	T	C	4: 57,225,863	T451A	probably benign	Het
Ptprs	A	G	17: 56,417,429	Y1577H	probably damaging	Het
Rgr	C	T	14: 37,048,925	M1I	probably null	Het
Rxrg	A	T	1: 167,631,109	N257I	probably benign	Het
Sbno2	T	C	10: 80,086,312	D9G	probably damaging	Het
Scd1	T	C	19: 44,406,595	K64E	probably damaging	Het
Serpinb1a	T	A	13: 32,850,325	I28F	possibly damaging	Het
Sfmbt2	A	T	2: 10,402,007	E39V	probably damaging	Het
Slc29a1	A	G	17: 45,589,971	M89T	possibly damaging	Het
Slco4a1	T	A	2: 180,472,063	V431E	possibly damaging	Het
Smg1	C	T	7: 118,152,908	C2698Y	unknown	Het
Sptlc2	C	T	12: 87,350,377	D212N	probably benign	Het
St6galnac1	T	C	11: 116,767,073	T334A	possibly damaging	Het
Stim2	A	T	5: 53,998,921	D13V	possibly damaging	Het
Syne1	A	G	10: 5,231,592	W4248R	probably damaging	Het
Tanc1	T	C	2: 59,797,609	Y584H	probably benign	Het
Thoc6	C	A	17: 23,673,660		probably null	Het
Trim30a	T	A	7: 104,429,326	N181I	possibly damaging	Het
Tshz3	A	G	7: 36,770,569	D661G	probably benign	Het
Ttll8	C	A	15: 88,915,427	V604L	probably damaging	Het
Ubtfl1	A	G	9: 18,409,635	D153G	probably damaging	Het
Ufsp2	C	A	8: 45,983,624	N137K	probably benign	Het
Ugt2a3	A	G	5: 87,325,534	I508T	possibly damaging	Het
Uso1	G	A	5: 92,158,465	E94K	probably benign	Het
Usp54	A	G	14: 20,561,242	S1169P	probably benign	Het
Vmn1r235	C	T	17: 21,262,030	P206S	probably benign	Het
Vmn1r69	T	C	7: 10,581,068		probably benign	Het
Zfp263	T	A	16: 3,749,391	C523*	probably null	Het
Zfp799	G	T	17: 32,820,236	T352K	probably benign	Het
Zfr	T	A	15: 12,180,638	V951E	probably damaging	Het
Zfyve26	T	C	12: 79,284,152	D431G	probably benign	Het
Zswim9	C	A	7: 13,259,737	A831S	probably damaging	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101886147	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101885311	nonsense	probably null
IGL00972:Trip11	APN	12	101894337	missense	probably null	1.00
IGL01476:Trip11	APN	12	101898911	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101883345	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101878862	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101884631	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101871831	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101884488	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101885676	missense	probably benign
IGL01924:Trip11	APN	12	101886884	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101884313	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101895683	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101893521	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101883390	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101884001	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101886025	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101886838	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101883936	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101898925	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101883418	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101885019	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101894321	splice site	probably null
R0027:Trip11	UTSW	12	101885169	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101884757	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101884728	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101885672	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101884518	nonsense	probably null
R0573:Trip11	UTSW	12	101886860	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101885976	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101886160	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101912767	missense	unknown
R1647:Trip11	UTSW	12	101884392	nonsense	probably null
R1648:Trip11	UTSW	12	101884392	nonsense	probably null
R1856:Trip11	UTSW	12	101883333	nonsense	probably null
R2013:Trip11	UTSW	12	101837722	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101885360	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101873442	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101898977	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101878827	makesense	probably null
R2513:Trip11	UTSW	12	101837727	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101893694	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101894322	nonsense	probably null
R4124:Trip11	UTSW	12	101895698	nonsense	probably null
R4126:Trip11	UTSW	12	101895698	nonsense	probably null
R4128:Trip11	UTSW	12	101895698	nonsense	probably null
R4175:Trip11	UTSW	12	101895698	nonsense	probably null
R4176:Trip11	UTSW	12	101895698	nonsense	probably null
R4181:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101885868	nonsense	probably null
R4302:Trip11	UTSW	12	101893768	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101886939	missense	probably benign
R4342:Trip11	UTSW	12	101884316	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101886240	nonsense	probably null
R4586:Trip11	UTSW	12	101883341	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101837616	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101885290	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101885446	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101886806	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101884910	nonsense	probably null
R5017:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101884920	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101885601	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101885127	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101885665	nonsense	probably null
R5755:Trip11	UTSW	12	101885665	nonsense	probably null
R5890:Trip11	UTSW	12	101885972	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101883479	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101889742	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101898895	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101890600	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101885578	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101885531	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101885451	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101846620	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101837627	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101893683	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101885867	missense	probably benign	0.13
R7271:Trip11	UTSW	12	101884352	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101885198	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101884019	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101885380	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101885435	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101886974	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101844855	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101883537	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101878144	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101837665	missense	probably damaging	1.00
R8076:Trip11	UTSW	12	101883482	missense	probably damaging	1.00
R8288:Trip11	UTSW	12	101894384	missense	possibly damaging	0.73
R8294:Trip11	UTSW	12	101844901	missense	possibly damaging	0.93
R8318:Trip11	UTSW	12	101912804	missense	unknown
X0020:Trip11	UTSW	12	101885913	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GTTTTCCTAAAAGAAGGTCCTTGG -3'
(R):5'- ACTGAGTCAGAAGTGCCAGAC -3'

Sequencing Primer
(F):5'- GGTATTACAAAGCTGCCCTATGC -3'
(R):5'- AGACCCTGCTGACAGTCTTG -3'

Posted On

2019-05-15