Incidental Mutation 'R7133:Dnah1'
ID552853
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 31286076 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 2125 (V2125L)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably benign
Transcript: ENSMUST00000048603
AA Change: V2125L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: V2125L

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
Faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1672:Dnah1 UTSW 14 31276200 missense probably damaging 1.00
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31261590 missense probably damaging 1.00
R7472:Dnah1 UTSW 14 31300791 missense possibly damaging 0.80
R7499:Dnah1 UTSW 14 31315122 nonsense probably null
R7526:Dnah1 UTSW 14 31287876 missense possibly damaging 0.49
R7560:Dnah1 UTSW 14 31304983 missense probably benign
R7574:Dnah1 UTSW 14 31319908 missense probably benign 0.00
R7617:Dnah1 UTSW 14 31284782 missense possibly damaging 0.80
R7620:Dnah1 UTSW 14 31303906 missense possibly damaging 0.47
R7692:Dnah1 UTSW 14 31292338 missense probably benign 0.00
R7702:Dnah1 UTSW 14 31310909 missense probably benign
R7786:Dnah1 UTSW 14 31262521 missense probably damaging 1.00
RF006:Dnah1 UTSW 14 31307875 missense probably benign 0.08
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- CCCTAAGTGGCCACTATTCATTG -3'
(R):5'- GCTGATAGAGCCCTGGTTCATC -3'

Sequencing Primer
(F):5'- CCACTATTCATTGAGGGGGAAATCC -3'
(R):5'- GATAGAGCCCTGGTTCATCTTCTC -3'
Posted On2019-05-15