Incidental Mutation 'R7133:Asic1'
ID552861
Institutional Source Beutler Lab
Gene Symbol Asic1
Ensembl Gene ENSMUSG00000023017
Gene Nameacid-sensing (proton-gated) ion channel 1
SynonymsASIC1a, ASICalpha, B530003N02Rik, ASIC, Accn2, BNaC2, ASIC1 beta
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99670368-99701130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99672087 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 96 (N96K)
Ref Sequence ENSEMBL: ENSMUSP00000023758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023758]
Predicted Effect probably damaging
Transcript: ENSMUST00000023758
AA Change: N96K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023758
Gene: ENSMUSG00000023017
AA Change: N96K

DomainStartEndE-ValueType
Pfam:ASC 21 454 9.9e-95 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acid-sensing ion channel (ASIC) family of proteins, which are part of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. Members of the ASIC family are sensitive to amiloride and function in neurotransmission. The encoded proteins function in learning, pain transduction, touch sensation, and development of memory and fear. Alternatively spliced transcript variants have been described. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous mutation of this gene results in absence of H+-gated currents in hippocampal neurons, impaired long term potentiation, reduced excitatory postsynaptic potentials, and defective spatial learning and eye blink conditioning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Asic1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01413:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01418:Asic1 APN 15 99672117 missense probably damaging 0.99
IGL01718:Asic1 APN 15 99672002 missense probably damaging 1.00
IGL01941:Asic1 APN 15 99699101 missense possibly damaging 0.95
IGL01993:Asic1 APN 15 99697472 missense probably benign 0.01
IGL02097:Asic1 APN 15 99694686 splice site probably benign
IGL03028:Asic1 APN 15 99672157 missense probably benign 0.03
IGL03082:Asic1 APN 15 99696547 missense probably benign
IGL03183:Asic1 APN 15 99672017 missense probably benign 0.43
IGL03231:Asic1 APN 15 99699102 missense probably benign 0.42
R0111:Asic1 UTSW 15 99696983 missense probably damaging 1.00
R0243:Asic1 UTSW 15 99698617 unclassified probably benign
R0316:Asic1 UTSW 15 99671938 missense probably benign 0.03
R0518:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0520:Asic1 UTSW 15 99695535 missense probably damaging 1.00
R0521:Asic1 UTSW 15 99698819 missense probably damaging 1.00
R0610:Asic1 UTSW 15 99698899 missense probably benign 0.14
R1034:Asic1 UTSW 15 99698058 missense probably damaging 1.00
R1666:Asic1 UTSW 15 99699125 missense probably damaging 1.00
R1796:Asic1 UTSW 15 99696654 missense probably null 0.99
R1993:Asic1 UTSW 15 99671884 missense probably damaging 1.00
R2130:Asic1 UTSW 15 99671875 missense possibly damaging 0.73
R2180:Asic1 UTSW 15 99671965 missense probably benign
R2895:Asic1 UTSW 15 99696602 missense probably benign 0.22
R3793:Asic1 UTSW 15 99672025 nonsense probably null
R3848:Asic1 UTSW 15 99672933 missense probably benign 0.01
R5115:Asic1 UTSW 15 99672052 missense probably damaging 0.97
R5186:Asic1 UTSW 15 99698803 unclassified probably benign
R5187:Asic1 UTSW 15 99698803 unclassified probably benign
R5409:Asic1 UTSW 15 99698803 unclassified probably benign
R6011:Asic1 UTSW 15 99699079 missense probably benign 0.05
R6383:Asic1 UTSW 15 99698880 missense probably damaging 0.96
R7255:Asic1 UTSW 15 99697457 missense probably damaging 0.97
R7587:Asic1 UTSW 15 99695590 missense probably damaging 1.00
R8012:Asic1 UTSW 15 99696651 missense possibly damaging 0.92
R8030:Asic1 UTSW 15 99694841 missense possibly damaging 0.56
R8089:Asic1 UTSW 15 99698087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGAGCGGCTGTCTCTGAAG -3'
(R):5'- CTGGTACTGGCATGATCTCAG -3'

Sequencing Primer
(F):5'- TCTCTGAAGCGGGCACTGTG -3'
(R):5'- CCTTGAGCGGCAGGTTTAAAG -3'
Posted On2019-05-15