Incidental Mutation 'R7133:Zfp263'
ID552862
Institutional Source Beutler Lab
Gene Symbol Zfp263
Ensembl Gene ENSMUSG00000022529
Gene Namezinc finger protein 263
SynonymsmFPM315, 1200014J04Rik, NT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location3744093-3750790 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 3749391 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 523 (C523*)
Ref Sequence ENSEMBL: ENSMUSP00000023176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023176] [ENSMUST00000161630] [ENSMUST00000162207]
Predicted Effect probably null
Transcript: ENSMUST00000023176
AA Change: C523*
SMART Domains Protein: ENSMUSP00000023176
Gene: ENSMUSG00000022529
AA Change: C523*

DomainStartEndE-ValueType
SCAN 39 151 5.15e-71 SMART
KRAB 219 279 1.86e-9 SMART
ZnF_C2H2 378 400 1.45e-2 SMART
ZnF_C2H2 434 456 3.11e-2 SMART
ZnF_C2H2 462 484 1.2e-3 SMART
ZnF_C2H2 490 512 6.52e-5 SMART
ZnF_C2H2 518 540 1.98e-4 SMART
ZnF_C2H2 572 594 2.4e-3 SMART
ZnF_C2H2 600 622 4.87e-4 SMART
ZnF_C2H2 628 650 1.1e-2 SMART
ZnF_C2H2 656 678 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161630
SMART Domains Protein: ENSMUSP00000123725
Gene: ENSMUSG00000022529

DomainStartEndE-ValueType
SCAN 39 143 1.61e-63 SMART
Predicted Effect probably null
Transcript: ENSMUST00000162207
AA Change: C235*
SMART Domains Protein: ENSMUSP00000124433
Gene: ENSMUSG00000022529
AA Change: C235*

DomainStartEndE-ValueType
ZnF_C2H2 90 112 1.45e-2 SMART
ZnF_C2H2 146 168 3.11e-2 SMART
ZnF_C2H2 174 196 1.2e-3 SMART
ZnF_C2H2 202 224 6.52e-5 SMART
ZnF_C2H2 230 252 1.98e-4 SMART
ZnF_C2H2 284 306 2.4e-3 SMART
ZnF_C2H2 312 334 4.87e-4 SMART
ZnF_C2H2 340 362 1.1e-2 SMART
ZnF_C2H2 368 390 1.72e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Zfp263
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Zfp263 APN 16 3745846 missense probably benign 0.00
IGL01112:Zfp263 APN 16 3748912 missense probably benign 0.09
IGL02049:Zfp263 APN 16 3744618 missense probably damaging 0.97
IGL02534:Zfp263 APN 16 3746415 unclassified probably benign
IGL02674:Zfp263 APN 16 3746765 unclassified probably benign
IGL03065:Zfp263 APN 16 3746480 missense probably benign
IGL03105:Zfp263 APN 16 3748960 missense probably damaging 1.00
IGL03153:Zfp263 APN 16 3746880 missense possibly damaging 0.56
IGL02796:Zfp263 UTSW 16 3746876 missense probably benign 0.03
R1201:Zfp263 UTSW 16 3749430 missense probably damaging 1.00
R1414:Zfp263 UTSW 16 3749296 missense probably damaging 1.00
R1448:Zfp263 UTSW 16 3746459 missense probably benign 0.18
R3085:Zfp263 UTSW 16 3749716 missense probably damaging 1.00
R4368:Zfp263 UTSW 16 3744906 unclassified probably benign
R4989:Zfp263 UTSW 16 3749128 missense probably damaging 1.00
R5072:Zfp263 UTSW 16 3746840 missense possibly damaging 0.84
R5073:Zfp263 UTSW 16 3746840 missense possibly damaging 0.84
R5074:Zfp263 UTSW 16 3746840 missense possibly damaging 0.84
R5122:Zfp263 UTSW 16 3749855 missense probably damaging 0.99
R5705:Zfp263 UTSW 16 3746454 missense probably benign 0.00
R6140:Zfp263 UTSW 16 3748217 missense probably benign 0.10
R6879:Zfp263 UTSW 16 3749855 missense probably damaging 0.99
R7216:Zfp263 UTSW 16 3744571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCACCAGAGAATACATGC -3'
(R):5'- ATGCCCTGCCGGAAACTTTTC -3'

Sequencing Primer
(F):5'- TCCAGTGCAATGCCTGTG -3'
(R):5'- TTCATGCCTTGACCACAC -3'
Posted On2019-05-15