Incidental Mutation 'R7133:Zfp799'
ID552866
Institutional Source Beutler Lab
Gene Symbol Zfp799
Ensembl Gene ENSMUSG00000095253
Gene Namezinc finger protein 799
Synonyms6030490I01Rik
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_177359.4; MGI:2443934

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location32815449-32830261 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32820236 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 352 (T352K)
Ref Sequence ENSEMBL: ENSMUSP00000144480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179695] [ENSMUST00000201499] [ENSMUST00000201876] [ENSMUST00000202759] [ENSMUST00000202988]
Predicted Effect probably benign
Transcript: ENSMUST00000179695
AA Change: T351K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136298
Gene: ENSMUSG00000095253
AA Change: T351K

DomainStartEndE-ValueType
KRAB 3 60 1.22e-9 SMART
low complexity region 97 110 N/A INTRINSIC
ZnF_C2H2 194 216 1.2e-3 SMART
ZnF_C2H2 222 244 1.28e-3 SMART
ZnF_C2H2 250 272 4.87e-4 SMART
ZnF_C2H2 278 300 9.08e-4 SMART
ZnF_C2H2 306 328 2.27e-4 SMART
ZnF_C2H2 334 356 1.53e-1 SMART
ZnF_C2H2 360 382 4.34e-1 SMART
ZnF_C2H2 388 410 1.84e-4 SMART
ZnF_C2H2 416 438 9.58e-3 SMART
ZnF_C2H2 444 466 6.32e-3 SMART
ZnF_C2H2 472 494 2.95e-3 SMART
ZnF_C2H2 500 522 2.2e-2 SMART
ZnF_C2H2 528 550 1.56e-2 SMART
ZnF_C2H2 556 578 2.4e-3 SMART
ZnF_C2H2 584 606 2.53e-2 SMART
ZnF_C2H2 612 634 4.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201499
SMART Domains Protein: ENSMUSP00000143907
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201876
SMART Domains Protein: ENSMUSP00000144187
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 61 5.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202759
SMART Domains Protein: ENSMUSP00000144087
Gene: ENSMUSG00000095253

DomainStartEndE-ValueType
KRAB 4 63 5.6e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202988
AA Change: T352K

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000144480
Gene: ENSMUSG00000095253
AA Change: T352K

DomainStartEndE-ValueType
KRAB 4 61 1.22e-9 SMART
low complexity region 98 111 N/A INTRINSIC
ZnF_C2H2 195 217 1.2e-3 SMART
ZnF_C2H2 223 245 1.28e-3 SMART
ZnF_C2H2 251 273 4.87e-4 SMART
ZnF_C2H2 279 301 9.08e-4 SMART
ZnF_C2H2 307 329 2.27e-4 SMART
ZnF_C2H2 335 357 1.53e-1 SMART
ZnF_C2H2 361 383 4.34e-1 SMART
ZnF_C2H2 389 411 1.84e-4 SMART
ZnF_C2H2 417 439 9.58e-3 SMART
ZnF_C2H2 445 467 6.32e-3 SMART
ZnF_C2H2 473 495 2.95e-3 SMART
ZnF_C2H2 501 523 2.2e-2 SMART
ZnF_C2H2 529 551 1.56e-2 SMART
ZnF_C2H2 557 579 2.4e-3 SMART
ZnF_C2H2 585 607 2.53e-2 SMART
ZnF_C2H2 613 635 4.47e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Zfp799
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01667:Zfp799 APN 17 32821820 missense possibly damaging 0.73
P0016:Zfp799 UTSW 17 32819357 missense possibly damaging 0.79
R0116:Zfp799 UTSW 17 32821035 missense possibly damaging 0.96
R0326:Zfp799 UTSW 17 32820726 missense possibly damaging 0.73
R1487:Zfp799 UTSW 17 32820677 missense possibly damaging 0.85
R1863:Zfp799 UTSW 17 32819400 missense probably damaging 1.00
R1929:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R1983:Zfp799 UTSW 17 32822110 missense probably damaging 1.00
R2127:Zfp799 UTSW 17 32819498 missense possibly damaging 0.80
R2271:Zfp799 UTSW 17 32821803 missense probably damaging 1.00
R2697:Zfp799 UTSW 17 32820240 nonsense probably null
R5134:Zfp799 UTSW 17 32820441 missense probably damaging 1.00
R5613:Zfp799 UTSW 17 32819990 missense probably damaging 0.98
R5839:Zfp799 UTSW 17 32822112 missense probably null 0.99
R6389:Zfp799 UTSW 17 32820578 missense probably damaging 1.00
R6414:Zfp799 UTSW 17 32820285 missense probably damaging 1.00
R6475:Zfp799 UTSW 17 32820846 missense probably damaging 0.99
R6593:Zfp799 UTSW 17 32819790 missense probably damaging 1.00
R7543:Zfp799 UTSW 17 32820560 missense probably benign 0.11
R7883:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7889:Zfp799 UTSW 17 32819499 nonsense probably null
R7966:Zfp799 UTSW 17 32820282 missense probably damaging 1.00
R7972:Zfp799 UTSW 17 32819499 nonsense probably null
Z1176:Zfp799 UTSW 17 32820216 nonsense probably null
Z1177:Zfp799 UTSW 17 32830219 start gained probably benign
Z1177:Zfp799 UTSW 17 32830221 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGTTCGTGTATCTGAACTTGACG -3'
(R):5'- CTCCCTGCTGACGCATGAG -3'

Sequencing Primer
(F):5'- CCGGTATGAATCAACTCGTGG -3'
(R):5'- AAGCCCTACGTGTGTAAGC -3'
Posted On2019-05-15