Incidental Mutation 'R7133:Slc29a1'
ID552867
Institutional Source Beutler Lab
Gene Symbol Slc29a1
Ensembl Gene ENSMUSG00000023942
Gene Namesolute carrier family 29 (nucleoside transporters), member 1
SynonymsENT1, 1200014D21Rik, NBMPR-sensitive equilibrative nucleoside transporter
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location45585200-45599606 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45589971 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 89 (M89T)
Ref Sequence ENSEMBL: ENSMUSP00000129242 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051574] [ENSMUST00000064889] [ENSMUST00000097317] [ENSMUST00000163492] [ENSMUST00000163905] [ENSMUST00000164217] [ENSMUST00000164618] [ENSMUST00000164769] [ENSMUST00000166119] [ENSMUST00000166633] [ENSMUST00000167195] [ENSMUST00000167332] [ENSMUST00000167692] [ENSMUST00000168274] [ENSMUST00000169729] [ENSMUST00000170113] [ENSMUST00000170488] [ENSMUST00000171081] [ENSMUST00000171847] [ENSMUST00000172301]
Predicted Effect probably benign
Transcript: ENSMUST00000051574
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000063096
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000064889
AA Change: M89T

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063757
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097317
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000094923
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163492
AA Change: M89T

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000129242
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163905
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129240
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164217
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131646
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164618
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000126934
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
transmembrane domain 109 130 N/A INTRINSIC
transmembrane domain 135 157 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164769
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131116
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 358 2.7e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166119
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128763
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166633
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131075
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 195 1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167195
AA Change: M57T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133162
Gene: ENSMUSG00000023942
AA Change: M57T

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167332
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131483
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167692
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131976
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 458 4.5e-131 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168274
Predicted Effect probably benign
Transcript: ENSMUST00000169729
AA Change: M57T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000127343
Gene: ENSMUSG00000023942
AA Change: M57T

DomainStartEndE-ValueType
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170113
SMART Domains Protein: ENSMUSP00000128304
Gene: ENSMUSG00000023942

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170488
Predicted Effect probably benign
Transcript: ENSMUST00000171081
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131217
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 262 8.4e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171847
AA Change: M89T

PolyPhen 2 Score 0.497 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000126703
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Nucleoside_tran 144 456 2.1e-130 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172301
AA Change: M89T

PolyPhen 2 Score 0.364 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129345
Gene: ENSMUSG00000023942
AA Change: M89T

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
transmembrane domain 80 102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the equilibrative nucleoside transporter family. The gene encodes a transmembrane glycoprotein that localizes to the plasma and mitochondrial membranes and mediates the cellular uptake of nucleosides from the surrounding medium. The protein is categorized as an equilibrative (as opposed to concentrative) transporter that is sensitive to inhibition by nitrobenzylthioinosine (NBMPR). Nucleoside transporters are required for nucleotide synthesis in cells that lack de novo nucleoside synthesis pathways, and are also necessary for the uptake of cytotoxic nucleosides used for cancer and viral chemotherapies. Multiple alternatively spliced variants, encoding the same protein, have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null allele exhibit a slightly decreased body weight, increased alcohol preference and alcohol consumption, and reduced hypnotic and ataxic responses to ethanol associated with a reduction in adenosine tone. Adenosine uptake is almost completely abolished in mice homozygous for a knock-out allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Ptprs A G 17: 56,417,429 Y1577H probably damaging Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Slc29a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00562:Slc29a1 APN 17 45589992 missense probably damaging 1.00
IGL01617:Slc29a1 APN 17 45589449 missense probably benign 0.02
IGL02154:Slc29a1 APN 17 45586163 missense probably damaging 1.00
soldate UTSW 17 45586263 missense probably damaging 1.00
veteran UTSW 17 45589921 critical splice donor site probably null
veterinarian UTSW 17 45586109 missense probably damaging 1.00
workhorse UTSW 17 45589066 nonsense probably null
R0288:Slc29a1 UTSW 17 45589804 missense probably damaging 1.00
R1168:Slc29a1 UTSW 17 45590278 missense probably damaging 1.00
R1676:Slc29a1 UTSW 17 45589010 missense probably damaging 0.98
R1777:Slc29a1 UTSW 17 45587308 missense probably damaging 1.00
R2032:Slc29a1 UTSW 17 45586109 missense probably damaging 1.00
R2413:Slc29a1 UTSW 17 45585717 missense probably damaging 1.00
R3917:Slc29a1 UTSW 17 45588973 splice site probably null
R4513:Slc29a1 UTSW 17 45589066 nonsense probably null
R4583:Slc29a1 UTSW 17 45589956 missense possibly damaging 0.67
R5244:Slc29a1 UTSW 17 45588413 unclassified probably benign
R6174:Slc29a1 UTSW 17 45589928 missense probably damaging 1.00
R6284:Slc29a1 UTSW 17 45589921 critical splice donor site probably null
R6446:Slc29a1 UTSW 17 45589245 missense possibly damaging 0.88
R6607:Slc29a1 UTSW 17 45588927 splice site probably null
R7153:Slc29a1 UTSW 17 45585762 missense probably damaging 1.00
R7248:Slc29a1 UTSW 17 45592182 missense probably damaging 1.00
R7271:Slc29a1 UTSW 17 45588362 missense probably benign 0.01
R7604:Slc29a1 UTSW 17 45592324 splice site probably null
R7811:Slc29a1 UTSW 17 45586263 missense probably damaging 1.00
R8406:Slc29a1 UTSW 17 45589780 missense probably damaging 1.00
X0067:Slc29a1 UTSW 17 45590325 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATCCGAACAGATTGAGAGATCC -3'
(R):5'- GCTTTCAAGGCCTGGTTCTG -3'

Sequencing Primer
(F):5'- CCGAACAGATTGAGAGATCCTAGGAG -3'
(R):5'- AAGGCCTGGTTCTGTGCCTC -3'
Posted On2019-05-15