Incidental Mutation 'R7133:Ptprs'
ID552869
Institutional Source Beutler Lab
Gene Symbol Ptprs
Ensembl Gene ENSMUSG00000013236
Gene Nameprotein tyrosine phosphatase, receptor type, S
SynonymsPtpt9, PTP-NU3, RPTPsigma, PTPsigma
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7133 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location56412426-56476483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56417429 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1577 (Y1577H)
Ref Sequence ENSEMBL: ENSMUSP00000064048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223859]
PDB Structure
Crystal structure of mouse PTPsigma [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000067538
AA Change: Y1577H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: Y1577H

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 605 692 9.69e-9 SMART
FN3 707 796 2.42e-9 SMART
FN3 811 890 2.22e0 SMART
FN3 905 995 8.31e-8 SMART
FN3 1009 1085 3.22e-5 SMART
low complexity region 1164 1177 N/A INTRINSIC
transmembrane domain 1259 1281 N/A INTRINSIC
PTPc 1351 1609 1.54e-136 SMART
PTPc 1638 1900 3.12e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086828
AA Change: Y1171H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: Y1171H

DomainStartEndE-ValueType
low complexity region 6 23 N/A INTRINSIC
IGc2 45 114 3.38e-10 SMART
IGc2 147 214 2.4e-15 SMART
IGc2 244 305 8.26e-5 SMART
FN3 319 398 2.8e-14 SMART
FN3 414 497 3.24e-10 SMART
FN3 512 590 3.17e-13 SMART
FN3 603 679 2.54e-3 SMART
low complexity region 758 771 N/A INTRINSIC
transmembrane domain 853 875 N/A INTRINSIC
PTPc 945 1203 1.54e-136 SMART
PTPc 1232 1494 3.12e-128 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000223859
AA Change: Y1167H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 98% (91/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T A 10: 79,066,639 K614N probably benign Het
2610008E11Rik T G 10: 79,066,640 K614T probably benign Het
Ahsa1 T A 12: 87,270,342 S120R probably benign Het
Anapc16 G A 10: 59,996,480 T37I possibly damaging Het
Arid2 C A 15: 96,378,875 P1606H probably damaging Het
Ash1l TATCTCCTTTTCCAAAAA TA 3: 88,983,457 probably null Het
Asic1 T A 15: 99,672,087 N96K probably damaging Het
Asph A T 4: 9,484,575 D582E probably benign Het
Astn1 A G 1: 158,572,987 D528G probably damaging Het
Atp9b A G 18: 80,909,656 V164A Het
Cbx6 C T 15: 79,828,665 G187D possibly damaging Het
Cct7 A G 6: 85,466,645 T332A probably benign Het
Clca4a A T 3: 144,961,890 L440* probably null Het
Crybg2 A T 4: 134,065,443 I130F probably benign Het
Crybg3 T C 16: 59,536,804 E798G probably damaging Het
Ctnnd2 A G 15: 30,480,849 E81G possibly damaging Het
Cwc22 C T 2: 77,929,478 R75H possibly damaging Het
Cym T G 3: 107,214,214 D254A probably damaging Het
D1Ertd622e G A 1: 97,645,920 P140L probably benign Het
Dcaf11 T A 14: 55,568,926 probably null Het
Dctn1 A T 6: 83,180,044 probably null Het
Dennd5a C T 7: 109,896,242 probably null Het
Dmpk T A 7: 19,087,307 C217S probably damaging Het
Dnah1 C A 14: 31,286,076 V2125L probably benign Het
Exoc4 G A 6: 33,438,473 A427T probably benign Het
Farp2 G T 1: 93,621,234 V1021F probably damaging Het
Flg2 T C 3: 93,219,762 S1994P unknown Het
Fmnl1 T C 11: 103,181,784 probably null Het
Frem2 T A 3: 53,572,339 I1978F possibly damaging Het
Gan T A 8: 117,187,230 C122* probably null Het
Gpr25 T A 1: 136,260,821 Y18F probably damaging Het
Hoxa7 C T 6: 52,215,740 E223K probably benign Het
Hypk A G 2: 121,453,480 probably null Het
Ibsp A T 5: 104,302,306 K27* probably null Het
Ighv6-5 T A 12: 114,416,775 T41S probably benign Het
Ighv9-4 T C 12: 114,300,137 M59V probably benign Het
Il17rb T C 14: 29,996,871 D418G probably damaging Het
Ints5 T A 19: 8,895,559 V294E probably damaging Het
Irx6 G A 8: 92,678,413 C303Y probably damaging Het
Itih3 T A 14: 30,917,698 I389F probably damaging Het
Lama1 C T 17: 67,782,146 T1604I Het
Lama3 C A 18: 12,539,786 Q873K probably benign Het
Lhx1 T G 11: 84,519,920 S284R probably benign Het
Lrba T A 3: 86,394,931 probably null Het
Lrg1 C T 17: 56,120,592 G127R possibly damaging Het
Mapre1 T A 2: 153,764,963 L205H probably benign Het
Meltf A G 16: 31,892,799 N581S probably damaging Het
Mgat5 A C 1: 127,365,189 M149L probably benign Het
Myh1 A G 11: 67,202,586 T168A probably benign Het
Naalad2 C T 9: 18,327,377 V681I probably benign Het
Olfr584 T A 7: 103,085,998 L155Q probably damaging Het
Olfr78 A G 7: 102,742,317 S229P probably damaging Het
Pcnx2 T C 8: 125,801,504 T1326A probably benign Het
Peg3 A T 7: 6,708,945 C1093S probably damaging Het
Pidd1 T C 7: 141,439,900 S650G probably benign Het
Pik3c2b T C 1: 133,090,234 S945P possibly damaging Het
Plec T C 15: 76,176,027 T3237A possibly damaging Het
Prpf3 A T 3: 95,833,740 probably null Het
Prpf4b C A 13: 34,901,494 H974Q probably benign Het
Ptpn3 T C 4: 57,225,863 T451A probably benign Het
Rgr C T 14: 37,048,925 M1I probably null Het
Rxrg A T 1: 167,631,109 N257I probably benign Het
Sbno2 T C 10: 80,086,312 D9G probably damaging Het
Scd1 T C 19: 44,406,595 K64E probably damaging Het
Serpinb1a T A 13: 32,850,325 I28F possibly damaging Het
Sfmbt2 A T 2: 10,402,007 E39V probably damaging Het
Slc29a1 A G 17: 45,589,971 M89T possibly damaging Het
Slco4a1 T A 2: 180,472,063 V431E possibly damaging Het
Smg1 C T 7: 118,152,908 C2698Y unknown Het
Sptlc2 C T 12: 87,350,377 D212N probably benign Het
St6galnac1 T C 11: 116,767,073 T334A possibly damaging Het
Stim2 A T 5: 53,998,921 D13V possibly damaging Het
Syne1 A G 10: 5,231,592 W4248R probably damaging Het
Tanc1 T C 2: 59,797,609 Y584H probably benign Het
Thoc6 C A 17: 23,673,660 probably null Het
Trim30a T A 7: 104,429,326 N181I possibly damaging Het
Trip11 T A 12: 101,884,070 Q1245L probably damaging Het
Tshz3 A G 7: 36,770,569 D661G probably benign Het
Ttll8 C A 15: 88,915,427 V604L probably damaging Het
Ubtfl1 A G 9: 18,409,635 D153G probably damaging Het
Ufsp2 C A 8: 45,983,624 N137K probably benign Het
Ugt2a3 A G 5: 87,325,534 I508T possibly damaging Het
Uso1 G A 5: 92,158,465 E94K probably benign Het
Usp54 A G 14: 20,561,242 S1169P probably benign Het
Vmn1r235 C T 17: 21,262,030 P206S probably benign Het
Vmn1r69 T C 7: 10,581,068 probably benign Het
Zfp263 T A 16: 3,749,391 C523* probably null Het
Zfp799 G T 17: 32,820,236 T352K probably benign Het
Zfr T A 15: 12,180,638 V951E probably damaging Het
Zfyve26 T C 12: 79,284,152 D431G probably benign Het
Zswim9 C A 7: 13,259,737 A831S probably damaging Het
Other mutations in Ptprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Ptprs APN 17 56458243 missense probably damaging 0.99
IGL01388:Ptprs APN 17 56421261 missense probably damaging 1.00
IGL01568:Ptprs APN 17 56413958 missense probably damaging 1.00
IGL01781:Ptprs APN 17 56435676 missense probably damaging 1.00
IGL02499:Ptprs APN 17 56437884 missense probably damaging 1.00
IGL02576:Ptprs APN 17 56414958 missense probably damaging 1.00
IGL02736:Ptprs APN 17 56458248 missense possibly damaging 0.88
IGL02871:Ptprs APN 17 56447443 missense probably damaging 1.00
IGL02946:Ptprs APN 17 56424032 missense probably benign
IGL03061:Ptprs APN 17 56418830 missense probably damaging 0.96
IGL03347:Ptprs APN 17 56435972 missense probably benign 0.07
IGL03351:Ptprs APN 17 56437943 missense probably damaging 1.00
P0019:Ptprs UTSW 17 56447474 splice site probably benign
PIT4434001:Ptprs UTSW 17 56454984 missense probably null 0.02
PIT4520001:Ptprs UTSW 17 56414980 missense probably damaging 1.00
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0240:Ptprs UTSW 17 56436087 unclassified probably null
R0504:Ptprs UTSW 17 56454220 missense possibly damaging 0.60
R0518:Ptprs UTSW 17 56419621 critical splice donor site probably null
R0539:Ptprs UTSW 17 56458255 missense probably damaging 0.97
R0620:Ptprs UTSW 17 56429103 missense possibly damaging 0.93
R0683:Ptprs UTSW 17 56414086 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1147:Ptprs UTSW 17 56423504 missense probably damaging 1.00
R1474:Ptprs UTSW 17 56424128 missense probably damaging 0.98
R1502:Ptprs UTSW 17 56437992 missense probably benign 0.00
R1817:Ptprs UTSW 17 56419527 missense probably damaging 1.00
R1844:Ptprs UTSW 17 56434510 missense probably damaging 1.00
R2077:Ptprs UTSW 17 56434990 missense probably null 0.26
R2086:Ptprs UTSW 17 56454984 missense probably null 0.02
R2149:Ptprs UTSW 17 56417706 missense probably damaging 1.00
R3618:Ptprs UTSW 17 56428965 missense probably benign 0.25
R3722:Ptprs UTSW 17 56417485 missense probably damaging 1.00
R3771:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3772:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R3773:Ptprs UTSW 17 56428978 missense possibly damaging 0.58
R4032:Ptprs UTSW 17 56413386 missense probably damaging 1.00
R4326:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4327:Ptprs UTSW 17 56447468 missense possibly damaging 0.83
R4480:Ptprs UTSW 17 56426404 missense possibly damaging 0.79
R4505:Ptprs UTSW 17 56451678 missense possibly damaging 0.57
R4507:Ptprs UTSW 17 56419014 missense probably damaging 1.00
R4588:Ptprs UTSW 17 56425534 missense probably damaging 1.00
R4662:Ptprs UTSW 17 56417666 missense probably damaging 1.00
R4708:Ptprs UTSW 17 56428067 missense probably damaging 1.00
R5016:Ptprs UTSW 17 56419070 missense probably damaging 1.00
R5416:Ptprs UTSW 17 56435724 missense probably damaging 1.00
R5447:Ptprs UTSW 17 56429128 missense possibly damaging 0.50
R6041:Ptprs UTSW 17 56419080 missense probably benign 0.00
R6329:Ptprs UTSW 17 56417427 nonsense probably null
R6377:Ptprs UTSW 17 56418935 missense probably damaging 1.00
R6605:Ptprs UTSW 17 56422195 missense probably damaging 1.00
R6749:Ptprs UTSW 17 56437884 missense probably damaging 1.00
R7113:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7114:Ptprs UTSW 17 56451697 missense probably benign 0.40
R7220:Ptprs UTSW 17 56418988 missense probably benign 0.29
R7423:Ptprs UTSW 17 56414793 missense probably damaging 1.00
R7440:Ptprs UTSW 17 56424256 missense possibly damaging 0.75
R7457:Ptprs UTSW 17 56419502 missense probably damaging 0.99
R7574:Ptprs UTSW 17 56423538 missense probably benign 0.00
R7851:Ptprs UTSW 17 56425482 missense probably benign
R7903:Ptprs UTSW 17 56424960 nonsense probably null
R7934:Ptprs UTSW 17 56425482 missense probably benign
R7986:Ptprs UTSW 17 56424960 nonsense probably null
RF014:Ptprs UTSW 17 56416935 missense probably damaging 1.00
X0028:Ptprs UTSW 17 56437831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCAACAAAATCACCGGCATG -3'
(R):5'- ATTGTGGTCCACTGCAGGTG -3'

Sequencing Primer
(F):5'- ACTGTGGGAGTCAGTTTTCACACC -3'
(R):5'- TGTGCACAGCCCTGACCTG -3'
Posted On2019-05-15