Incidental Mutation 'R0600:Mad2l2'
ID55287
Institutional Source Beutler Lab
Gene Symbol Mad2l2
Ensembl Gene ENSMUSG00000029003
Gene NameMAD2 mitotic arrest deficient-like 2
SynonymsG1-453-4, 2310033C13Rik, repro22, REV7, MAD2B
MMRRC Submission 038789-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0600 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location148130384-148145699 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 148140924 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 17 (D17G)
Ref Sequence ENSEMBL: ENSMUSP00000081146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030858] [ENSMUST00000030860] [ENSMUST00000056965] [ENSMUST00000084129] [ENSMUST00000105706] [ENSMUST00000105707] [ENSMUST00000132698] [ENSMUST00000140049] [ENSMUST00000168503]
PDB Structure
Structure of the Rev1 CTD-Rev3/7-Pol kappa RIR complex [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000030858
SMART Domains Protein: ENSMUSP00000030858
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000030860
AA Change: D17G

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030860
Gene: ENSMUSG00000029003
AA Change: D17G

DomainStartEndE-ValueType
Pfam:HORMA 12 184 1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000056965
SMART Domains Protein: ENSMUSP00000062348
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000084129
AA Change: D17G

PolyPhen 2 Score 0.737 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081146
Gene: ENSMUSG00000029003
AA Change: D17G

DomainStartEndE-ValueType
Pfam:HORMA 13 167 4.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105706
SMART Domains Protein: ENSMUSP00000101331
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105707
AA Change: D17G

PolyPhen 2 Score 0.106 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101332
Gene: ENSMUSG00000029003
AA Change: D17G

DomainStartEndE-ValueType
Pfam:HORMA 13 171 4.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000105708
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126261
Predicted Effect probably benign
Transcript: ENSMUST00000132698
AA Change: D17G

PolyPhen 2 Score 0.119 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122774
Gene: ENSMUSG00000029003
AA Change: D17G

DomainStartEndE-ValueType
Pfam:HORMA 12 168 2e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000140049
AA Change: D17G
SMART Domains Protein: ENSMUSP00000120481
Gene: ENSMUSG00000029003
AA Change: D17G

DomainStartEndE-ValueType
PDB:4FJO|C 32 107 1e-47 PDB
SCOP:d1go4a_ 32 107 1e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148742
Predicted Effect probably benign
Transcript: ENSMUST00000168503
SMART Domains Protein: ENSMUSP00000130188
Gene: ENSMUSG00000055401

DomainStartEndE-ValueType
FBOX 7 48 1e-4 SMART
FBA 66 250 2.51e-113 SMART
Meta Mutation Damage Score 0.7178 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the mitotic spindle assembly checkpoint that prevents the onset of anaphase until all chromosomes are properly aligned at the metaphase plate. The encoded protein, which is similar to MAD2L1, is capable of interacting with ADAM9, ADAM15, REV1, and REV3 proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes partial lethality between E13.5 and weaning, reduced body size, small testes and ovaries, infertility, and abnormal primordial germ cell apoptosis. Homozygotes for a null allele show increased neuroblast apoptosis and accumulation of double strand breaks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,357,660 S150P probably damaging Het
4932431P20Rik T A 7: 29,533,265 noncoding transcript Het
5530400C23Rik T G 6: 133,293,211 probably benign Het
Ahctf1 A C 1: 179,763,468 probably null Het
Ang5 T C 14: 43,962,749 V90A probably benign Het
Ano9 C T 7: 141,104,710 G442R probably damaging Het
Apaf1 G A 10: 91,060,052 T386I probably damaging Het
Apob C A 12: 8,006,440 H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 probably benign Het
Asxl1 T A 2: 153,399,904 D791E probably benign Het
Avl9 T C 6: 56,736,906 V383A probably benign Het
Btbd1 A C 7: 81,816,006 D197E probably damaging Het
C87499 A T 4: 88,629,299 I45K probably damaging Het
Camta2 T C 11: 70,673,959 I938V possibly damaging Het
Cdca7 C A 2: 72,483,467 A200D possibly damaging Het
Cep104 A T 4: 154,006,792 Y923F possibly damaging Het
Cep135 G C 5: 76,621,305 V601L probably benign Het
Ces2b G A 8: 104,835,910 G291S probably benign Het
Col6a6 C T 9: 105,761,440 G1400D probably damaging Het
Cyth2 T C 7: 45,813,117 E1G probably damaging Het
Dand5 A T 8: 84,816,292 L185Q probably damaging Het
Dck T C 5: 88,781,221 V253A probably benign Het
Ddx20 A G 3: 105,679,080 S650P probably damaging Het
Dicer1 G A 12: 104,706,864 P799S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eya2 G A 2: 165,769,237 C477Y probably damaging Het
Fam208b A T 13: 3,576,054 F1299I probably benign Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Galntl6 T C 8: 57,837,183 probably null Het
Gda A T 19: 21,434,303 F44I possibly damaging Het
Gli2 G A 1: 118,840,389 R703C probably damaging Het
Gm14085 A T 2: 122,514,398 I162F probably damaging Het
Golgb1 T A 16: 36,916,271 L1960Q probably damaging Het
Gramd1b T C 9: 40,308,355 D341G probably damaging Het
Grid2 G T 6: 63,503,435 A78S probably benign Het
Hao2 A T 3: 98,883,560 probably benign Het
Hook3 A G 8: 26,118,986 V10A probably benign Het
Kif20a A G 18: 34,629,209 E425G probably damaging Het
Lrp1 T C 10: 127,567,383 D2107G probably benign Het
Lrriq3 T C 3: 155,187,736 I358T possibly damaging Het
Mastl G T 2: 23,133,346 T455K probably benign Het
Mkln1 G T 6: 31,432,927 probably benign Het
Mmp1b A T 9: 7,387,947 Y16N possibly damaging Het
Mmp24 C T 2: 155,792,597 A79V probably benign Het
Mrps35 T A 6: 147,070,734 C292S possibly damaging Het
Myom1 T C 17: 71,120,648 F1435L possibly damaging Het
Nars2 C T 7: 97,039,923 H351Y probably damaging Het
Nat2 A T 8: 67,501,267 I10F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm5 A T 7: 104,153,869 Y462* probably null Het
Olfr1228 C A 2: 89,249,398 E87* probably null Het
Olfr1339 C T 4: 118,734,789 H87Y probably damaging Het
Olfr1508 T C 14: 52,463,509 I167V probably benign Het
Olfr322 C A 11: 58,666,160 F200L probably damaging Het
Olfr340 C A 2: 36,452,648 A21E probably benign Het
Olfr44 A T 9: 39,484,988 F85L probably benign Het
Olfr495 T A 7: 108,395,231 I37N probably damaging Het
Olfr855 T C 9: 19,585,304 S256P possibly damaging Het
Olfr926 T A 9: 38,877,815 I213N probably damaging Het
Otog A T 7: 46,251,395 probably benign Het
Pdcd2l A T 7: 34,192,807 D212E possibly damaging Het
Pex5 T C 6: 124,404,637 N213S probably benign Het
Pkn3 C T 2: 30,081,134 P238S probably benign Het
Prl2b1 A T 13: 27,390,740 probably null Het
Ptprb A T 10: 116,368,807 I1849L possibly damaging Het
Rasal3 G T 17: 32,393,526 S787Y probably damaging Het
Scn2a T A 2: 65,701,833 D596E possibly damaging Het
Sdhd A T 9: 50,603,764 V9D possibly damaging Het
Serinc5 T C 13: 92,708,057 S436P probably damaging Het
Slc27a1 C T 8: 71,584,164 P348L probably damaging Het
Smg1 G A 7: 118,160,383 probably benign Het
Sorl1 A T 9: 42,043,900 probably benign Het
Sprtn T A 8: 124,900,218 H112Q probably damaging Het
Tet2 A G 3: 133,467,602 M1633T probably benign Het
Tet2 T A 3: 133,467,725 D1592V probably benign Het
Tmem68 A T 4: 3,569,667 C8S probably damaging Het
Tnrc6a T A 7: 123,171,816 I943N probably benign Het
Trib2 A T 12: 15,794,068 V191D probably damaging Het
Tsc22d4 T C 5: 137,762,655 S113P probably damaging Het
Ttc21b T C 2: 66,239,570 R250G probably damaging Het
Ubr2 T C 17: 46,967,248 Y721C probably damaging Het
Ubtfl1 A T 9: 18,409,364 I63F probably damaging Het
Ush1c G A 7: 46,224,908 P171S probably benign Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vangl1 A G 3: 102,166,937 Y285H probably damaging Het
Virma A G 4: 11,498,769 D70G probably damaging Het
Vmn2r102 T C 17: 19,678,015 F431L probably benign Het
Wdr17 A G 8: 54,661,495 I662T probably damaging Het
Wisp2 G A 2: 163,825,313 C78Y probably damaging Het
Zfp160 G A 17: 21,027,006 R606H probably benign Het
Zfp369 C T 13: 65,296,434 R464C probably damaging Het
Other mutations in Mad2l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1574:Mad2l2 UTSW 4 148142972 unclassified probably benign
R6092:Mad2l2 UTSW 4 148143610 missense probably damaging 1.00
R6927:Mad2l2 UTSW 4 148140954 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- ATAGCCCGGTCGTAGATTGGAACC -3'
(R):5'- TGTCCGCTATCAGCCTCTGTTGAG -3'

Sequencing Primer
(F):5'- GGTTGCCTTGAGTCCCTACAG -3'
(R):5'- CTATCAGCCTCTGTTGAGGAGTG -3'
Posted On2013-07-11