Incidental Mutation 'R7134:Cfap65'
ID552877
Institutional Source Beutler Lab
Gene Symbol Cfap65
Ensembl Gene ENSMUSG00000047021
Gene Namecilia and flagella associated protein 65
SynonymsCcdc108, B230363K08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.528) question?
Stock #R7134 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74902071-74935599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 74926633 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 406 (R406Q)
Ref Sequence ENSEMBL: ENSMUSP00000092440 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094844]
Predicted Effect probably benign
Transcript: ENSMUST00000094844
AA Change: R406Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000092440
Gene: ENSMUSG00000047021
AA Change: R406Q

DomainStartEndE-ValueType
transmembrane domain 111 133 N/A INTRINSIC
low complexity region 212 223 N/A INTRINSIC
internal_repeat_1 745 890 9.31e-5 PROSPERO
internal_repeat_1 1167 1322 9.31e-5 PROSPERO
low complexity region 1350 1361 N/A INTRINSIC
low complexity region 1574 1592 N/A INTRINSIC
coiled coil region 1687 1724 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. The chicken ortholog of this gene is involved in the Rose-comb mutation, which is a large chromosome inversion, resulting in altered comb morphology and defects in sperm motility. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,959,252 F638S possibly damaging Het
Actl6b T A 5: 137,564,500 N159K probably damaging Het
Adam6a T G 12: 113,545,035 S343A probably benign Het
Ankrd17 G A 5: 90,232,314 T2505I probably damaging Het
Ankrd17 T C 5: 90,285,523 T728A probably benign Het
Asap2 G T 12: 21,265,963 E919* probably null Het
Atp10b A T 11: 43,245,464 I1140F probably damaging Het
Cep126 A T 9: 8,103,382 V209E probably damaging Het
Cldn1 T C 16: 26,371,626 M1V probably null Het
Cryl1 C T 14: 57,275,499 D304N probably benign Het
D3Ertd751e T C 3: 41,753,777 probably null Het
D630044L22Rik A T 17: 25,962,116 M156L probably benign Het
Ddx21 T C 10: 62,591,855 D423G possibly damaging Het
Dock2 T A 11: 34,310,363 M993L probably benign Het
Dupd1 A T 14: 21,677,061 I173N probably damaging Het
Eif4g1 C T 16: 20,681,502 A675V probably damaging Het
Eml1 C T 12: 108,506,551 S206L probably benign Het
Farp2 A C 1: 93,603,459 I560L probably benign Het
Fbn1 A T 2: 125,382,049 D593E probably benign Het
Fetub A G 16: 22,929,257 D61G possibly damaging Het
Fpgs T C 2: 32,686,629 K329E probably benign Het
Fpgt T C 3: 155,091,483 Y45C probably damaging Het
Gas2l1 A T 11: 5,061,106 C574* probably null Het
Gm13212 T A 4: 145,622,805 C271S possibly damaging Het
Gm6460 C T 5: 11,597,739 T148I possibly damaging Het
Gm9747 G T 1: 82,234,116 C12F unknown Het
H2-T23 T C 17: 36,031,817 Y143C probably damaging Het
Hhip A T 8: 79,992,513 S462T probably benign Het
Hnf1a C T 5: 114,953,387 G416R probably damaging Het
Hoxa5 C T 6: 52,204,043 C103Y probably damaging Het
Kansl3 G T 1: 36,351,767 D395E possibly damaging Het
March10 A G 11: 105,408,676 S116P probably benign Het
Med12l C T 3: 59,093,759 Q748* probably null Het
Mroh7 T A 4: 106,720,594 N296Y probably damaging Het
Mtbp T G 15: 55,558,565 D61E probably benign Het
Muc5b A T 7: 141,857,654 I1446L unknown Het
Myh15 T C 16: 49,081,342 V266A possibly damaging Het
Nap1l1 G A 10: 111,494,794 probably null Het
Napsa A G 7: 44,585,735 T315A probably benign Het
Nlrc5 A T 8: 94,479,722 I734F probably damaging Het
Nnt A G 13: 119,394,662 V183A probably damaging Het
Nploc4 A T 11: 120,385,788 D477E probably benign Het
Nrip3 A G 7: 109,765,488 S144P probably damaging Het
Ntng1 A T 3: 109,935,129 F109L probably benign Het
Olfr110 T A 17: 37,498,885 V78D probably damaging Het
Olfr303 G A 7: 86,395,544 probably benign Het
Olfr485 A G 7: 108,159,676 Y66H probably damaging Het
Olfr883 A G 9: 38,026,499 E231G probably benign Het
Pacsin1 G A 17: 27,702,733 D30N probably damaging Het
Pbld2 A T 10: 63,024,589 probably benign Het
Pcnx4 C T 12: 72,566,976 T565I probably damaging Het
Pdzk1 A T 3: 96,855,930 T225S probably benign Het
Phyhip T G 14: 70,467,199 I286S probably benign Het
Pkd1 T A 17: 24,594,112 Y3903N probably damaging Het
Plcb3 A T 19: 6,965,330 L222Q probably damaging Het
Plcd4 T A 1: 74,554,503 H262Q probably benign Het
Plekhh1 C T 12: 79,062,616 A474V probably benign Het
Plppr3 T C 10: 79,865,703 E435G probably damaging Het
Poln T A 5: 34,118,996 N305I possibly damaging Het
Pou3f2 T C 4: 22,486,874 T420A probably benign Het
Ppdpf T C 2: 181,187,730 Y17H probably damaging Het
Prrx2 C A 2: 30,878,473 T104K probably damaging Het
Ptprj A T 2: 90,464,478 L462H probably benign Het
Radil T C 5: 142,485,549 T991A probably damaging Het
Rbsn T C 6: 92,201,627 E147G probably damaging Het
Ror2 C T 13: 53,146,706 V35M probably benign Het
Rps6ka1 T C 4: 133,872,062 Q18R probably benign Het
Setbp1 T A 18: 78,859,519 D311V possibly damaging Het
Setd2 C T 9: 110,548,797 S560L possibly damaging Het
Slc12a5 A T 2: 164,974,958 I134F probably damaging Het
Svil A G 18: 5,116,080 D2035G probably damaging Het
Syngap1 T C 17: 26,960,011 Y665H probably damaging Het
Tbc1d9b T C 11: 50,152,692 Y547H possibly damaging Het
Tgm2 A G 2: 158,138,892 V83A probably benign Het
Tmem233 T C 5: 116,051,370 I117V probably benign Het
Tsen34 A G 7: 3,700,641 T293A probably damaging Het
Ttn A G 2: 76,878,679 V8752A unknown Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Uchl4 T C 9: 64,235,339 V34A probably damaging Het
Ugt2a2 C T 5: 87,460,576 R468H probably benign Het
Vmn2r102 A T 17: 19,677,487 T255S probably benign Het
Wdr6 T A 9: 108,573,365 N988I probably damaging Het
Wnk1 A T 6: 119,926,428 I2359N unknown Het
Ybey A G 10: 76,468,191 V59A probably benign Het
Zfp397 A G 18: 23,957,065 N142S probably benign Het
Zfy1 A T Y: 725,788 V659E probably damaging Het
Other mutations in Cfap65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Cfap65 APN 1 74919183 critical splice donor site probably null
IGL01526:Cfap65 APN 1 74911078 missense probably damaging 1.00
IGL01716:Cfap65 APN 1 74927194 missense probably benign
IGL01780:Cfap65 APN 1 74928348 nonsense probably null
IGL01993:Cfap65 APN 1 74920543 missense probably damaging 1.00
IGL02164:Cfap65 APN 1 74928145 missense possibly damaging 0.87
IGL02350:Cfap65 APN 1 74928348 nonsense probably null
IGL02357:Cfap65 APN 1 74928348 nonsense probably null
IGL02576:Cfap65 APN 1 74903458 missense probably damaging 1.00
IGL02756:Cfap65 APN 1 74905080 missense probably benign 0.00
IGL02792:Cfap65 APN 1 74927178 missense probably damaging 1.00
IGL02874:Cfap65 APN 1 74911108 nonsense probably null
IGL03101:Cfap65 APN 1 74928433 missense possibly damaging 0.61
IGL03348:Cfap65 APN 1 74927619 missense probably damaging 1.00
IGL03396:Cfap65 APN 1 74904642 missense probably damaging 1.00
PIT4131001:Cfap65 UTSW 1 74928342 missense probably benign 0.05
R0077:Cfap65 UTSW 1 74931918 missense probably damaging 1.00
R0227:Cfap65 UTSW 1 74931958 nonsense probably null
R0281:Cfap65 UTSW 1 74927071 missense probably damaging 1.00
R0312:Cfap65 UTSW 1 74904067 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929301 missense probably damaging 1.00
R0331:Cfap65 UTSW 1 74929302 missense probably damaging 1.00
R0347:Cfap65 UTSW 1 74926444 missense probably damaging 1.00
R0359:Cfap65 UTSW 1 74920601 missense probably benign 0.00
R0361:Cfap65 UTSW 1 74925440 missense probably damaging 1.00
R0465:Cfap65 UTSW 1 74916884 missense possibly damaging 0.92
R0549:Cfap65 UTSW 1 74918444 missense probably benign 0.01
R0646:Cfap65 UTSW 1 74902169 missense probably benign 0.09
R0734:Cfap65 UTSW 1 74918887 missense probably damaging 1.00
R0763:Cfap65 UTSW 1 74904682 missense probably damaging 0.99
R0990:Cfap65 UTSW 1 74921519 missense possibly damaging 0.60
R1079:Cfap65 UTSW 1 74902447 missense probably damaging 0.98
R1079:Cfap65 UTSW 1 74905713 missense probably damaging 0.99
R1083:Cfap65 UTSW 1 74918504 splice site probably benign
R1159:Cfap65 UTSW 1 74929340 missense probably damaging 1.00
R1282:Cfap65 UTSW 1 74925104 missense probably benign 0.03
R1644:Cfap65 UTSW 1 74917175 missense probably damaging 1.00
R1796:Cfap65 UTSW 1 74918948 missense probably damaging 1.00
R1950:Cfap65 UTSW 1 74907660 missense probably damaging 1.00
R2079:Cfap65 UTSW 1 74917199 missense probably benign 0.30
R2132:Cfap65 UTSW 1 74907691 missense probably damaging 1.00
R2136:Cfap65 UTSW 1 74917273 frame shift probably null
R2219:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2220:Cfap65 UTSW 1 74904025 missense probably damaging 1.00
R2291:Cfap65 UTSW 1 74926475 missense probably damaging 1.00
R2417:Cfap65 UTSW 1 74927186 small insertion probably benign
R3114:Cfap65 UTSW 1 74927132 missense probably damaging 1.00
R4202:Cfap65 UTSW 1 74920542 missense probably damaging 1.00
R4214:Cfap65 UTSW 1 74927681 missense possibly damaging 0.93
R4254:Cfap65 UTSW 1 74903358 missense probably benign 0.17
R4547:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4548:Cfap65 UTSW 1 74907612 missense probably damaging 1.00
R4588:Cfap65 UTSW 1 74904056 missense possibly damaging 0.92
R4657:Cfap65 UTSW 1 74925354 intron probably benign
R4701:Cfap65 UTSW 1 74918908 missense probably damaging 0.96
R4755:Cfap65 UTSW 1 74928361 missense probably damaging 1.00
R4820:Cfap65 UTSW 1 74927632 missense probably benign 0.06
R4831:Cfap65 UTSW 1 74917295 missense possibly damaging 0.93
R4866:Cfap65 UTSW 1 74925557 missense probably damaging 1.00
R4869:Cfap65 UTSW 1 74919261 missense probably benign 0.00
R4881:Cfap65 UTSW 1 74907613 missense probably damaging 1.00
R4884:Cfap65 UTSW 1 74903124 missense possibly damaging 0.47
R4950:Cfap65 UTSW 1 74906336 nonsense probably null
R5074:Cfap65 UTSW 1 74922978 missense probably benign 0.04
R5083:Cfap65 UTSW 1 74906441 missense probably damaging 1.00
R5164:Cfap65 UTSW 1 74926516 missense probably damaging 1.00
R5268:Cfap65 UTSW 1 74924902 missense probably benign 0.07
R5333:Cfap65 UTSW 1 74903175 missense probably benign 0.03
R5417:Cfap65 UTSW 1 74925100 missense probably damaging 1.00
R5582:Cfap65 UTSW 1 74907518 intron probably benign
R5669:Cfap65 UTSW 1 74924968 missense probably damaging 0.99
R6010:Cfap65 UTSW 1 74923031 missense probably damaging 1.00
R6084:Cfap65 UTSW 1 74920405 missense probably damaging 1.00
R6112:Cfap65 UTSW 1 74903139 missense probably benign 0.14
R6425:Cfap65 UTSW 1 74927709 missense probably benign 0.00
R6677:Cfap65 UTSW 1 74904685 missense probably damaging 1.00
R6693:Cfap65 UTSW 1 74917286 missense probably benign 0.00
R6838:Cfap65 UTSW 1 74932021 missense probably benign 0.06
R6861:Cfap65 UTSW 1 74925115 missense probably damaging 1.00
R6958:Cfap65 UTSW 1 74931899 missense possibly damaging 0.58
R7320:Cfap65 UTSW 1 74926604 missense probably damaging 0.99
R7340:Cfap65 UTSW 1 74921583 missense probably benign 0.07
R7426:Cfap65 UTSW 1 74920426 missense possibly damaging 0.92
R7529:Cfap65 UTSW 1 74926610 missense probably damaging 1.00
R7634:Cfap65 UTSW 1 74902434 missense probably damaging 1.00
R7654:Cfap65 UTSW 1 74933144 missense probably benign 0.44
R7704:Cfap65 UTSW 1 74928368 missense probably benign 0.19
R7727:Cfap65 UTSW 1 74926625 missense probably benign 0.00
R7895:Cfap65 UTSW 1 74933162 missense probably benign 0.05
RF009:Cfap65 UTSW 1 74905647 missense probably damaging 1.00
Z1176:Cfap65 UTSW 1 74910747 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCACCTGGTGATGGATGAGAC -3'
(R):5'- TGAGTTTTGCAGGGCTCCAG -3'

Sequencing Primer
(F):5'- CACCCTCCGGAAACTGATGATAGG -3'
(R):5'- AAGGGCAAGGATCTCTCA -3'
Posted On2019-05-15