Incidental Mutation 'R7134:Slc12a5'
ID552887
Institutional Source Beutler Lab
Gene Symbol Slc12a5
Ensembl Gene ENSMUSG00000017740
Gene Namesolute carrier family 12, member 5
SynonymsKCC2
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7134 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location164960802-164999731 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 164974958 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 134 (I134F)
Ref Sequence ENSEMBL: ENSMUSP00000144623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099092] [ENSMUST00000202136] [ENSMUST00000202223] [ENSMUST00000202479] [ENSMUST00000202623]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099092
AA Change: I111F

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096690
Gene: ENSMUSG00000017740
AA Change: I111F

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 304 5.2e-22 PFAM
Pfam:AA_permease_2 364 632 1e-17 PFAM
Pfam:AA_permease 389 676 1.9e-42 PFAM
Pfam:SLC12 688 814 2.1e-19 PFAM
Pfam:SLC12 807 959 1.8e-20 PFAM
low complexity region 978 1002 N/A INTRINSIC
Pfam:SLC12 1009 1115 2.1e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202136
AA Change: I111F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143973
Gene: ENSMUSG00000017740
AA Change: I111F

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 175 2.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202223
AA Change: I134F

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000143870
Gene: ENSMUSG00000017740
AA Change: I134F

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 1e-19 PFAM
Pfam:AA_permease_2 386 655 4.5e-15 PFAM
Pfam:AA_permease 412 699 3.7e-40 PFAM
Pfam:SLC12 711 837 7.2e-17 PFAM
Pfam:SLC12 830 982 6.2e-18 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1030 1133 8.6e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202479
AA Change: I111F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144540
Gene: ENSMUSG00000017740
AA Change: I111F

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 77 90 N/A INTRINSIC
Pfam:AA_permease 102 176 5.2e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000202623
AA Change: I134F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144623
Gene: ENSMUSG00000017740
AA Change: I134F

DomainStartEndE-ValueType
low complexity region 11 19 N/A INTRINSIC
low complexity region 100 113 N/A INTRINSIC
Pfam:AA_permease 125 327 5.3e-22 PFAM
Pfam:AA_permease_2 386 655 1.2e-17 PFAM
Pfam:AA_permease 412 699 2e-42 PFAM
Pfam:SLC12 711 837 2.1e-19 PFAM
Pfam:SLC12 830 982 1.8e-20 PFAM
low complexity region 1001 1025 N/A INTRINSIC
Pfam:SLC12 1032 1138 2.2e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] K-Cl cotransporters are proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The protein encoded by this gene is an integral membrane K-Cl cotransporter that can function in either a net efflux or influx pathway, depending on the chemical concentration gradients of potassium and chloride. The encoded protein can act as a homomultimer, or as a heteromultimer with other K-Cl cotransporters, to maintain chloride homeostasis in neurons. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die within a few minutes of birth of respiratory failure resulting from a motor nerve defect. Mice homozygous for a hypomorphic allele display postnatal lethality and tonic-clonic seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,959,252 F638S possibly damaging Het
Actl6b T A 5: 137,564,500 N159K probably damaging Het
Adam6a T G 12: 113,545,035 S343A probably benign Het
Ankrd17 G A 5: 90,232,314 T2505I probably damaging Het
Ankrd17 T C 5: 90,285,523 T728A probably benign Het
Asap2 G T 12: 21,265,963 E919* probably null Het
Atp10b A T 11: 43,245,464 I1140F probably damaging Het
Cep126 A T 9: 8,103,382 V209E probably damaging Het
Cfap65 C T 1: 74,926,633 R406Q probably benign Het
Cldn1 T C 16: 26,371,626 M1V probably null Het
Cryl1 C T 14: 57,275,499 D304N probably benign Het
D3Ertd751e T C 3: 41,753,777 probably null Het
D630044L22Rik A T 17: 25,962,116 M156L probably benign Het
Ddx21 T C 10: 62,591,855 D423G possibly damaging Het
Dock2 T A 11: 34,310,363 M993L probably benign Het
Dupd1 A T 14: 21,677,061 I173N probably damaging Het
Eif4g1 C T 16: 20,681,502 A675V probably damaging Het
Eml1 C T 12: 108,506,551 S206L probably benign Het
Farp2 A C 1: 93,603,459 I560L probably benign Het
Fbn1 A T 2: 125,382,049 D593E probably benign Het
Fetub A G 16: 22,929,257 D61G possibly damaging Het
Fpgs T C 2: 32,686,629 K329E probably benign Het
Fpgt T C 3: 155,091,483 Y45C probably damaging Het
Gas2l1 A T 11: 5,061,106 C574* probably null Het
Gm13212 T A 4: 145,622,805 C271S possibly damaging Het
Gm6460 C T 5: 11,597,739 T148I possibly damaging Het
Gm9747 G T 1: 82,234,116 C12F unknown Het
H2-T23 T C 17: 36,031,817 Y143C probably damaging Het
Hhip A T 8: 79,992,513 S462T probably benign Het
Hnf1a C T 5: 114,953,387 G416R probably damaging Het
Hoxa5 C T 6: 52,204,043 C103Y probably damaging Het
Kansl3 G T 1: 36,351,767 D395E possibly damaging Het
March10 A G 11: 105,408,676 S116P probably benign Het
Med12l C T 3: 59,093,759 Q748* probably null Het
Mroh7 T A 4: 106,720,594 N296Y probably damaging Het
Mtbp T G 15: 55,558,565 D61E probably benign Het
Muc5b A T 7: 141,857,654 I1446L unknown Het
Myh15 T C 16: 49,081,342 V266A possibly damaging Het
Nap1l1 G A 10: 111,494,794 probably null Het
Napsa A G 7: 44,585,735 T315A probably benign Het
Nlrc5 A T 8: 94,479,722 I734F probably damaging Het
Nnt A G 13: 119,394,662 V183A probably damaging Het
Nploc4 A T 11: 120,385,788 D477E probably benign Het
Nrip3 A G 7: 109,765,488 S144P probably damaging Het
Ntng1 A T 3: 109,935,129 F109L probably benign Het
Olfr110 T A 17: 37,498,885 V78D probably damaging Het
Olfr303 G A 7: 86,395,544 probably benign Het
Olfr485 A G 7: 108,159,676 Y66H probably damaging Het
Olfr883 A G 9: 38,026,499 E231G probably benign Het
Pacsin1 G A 17: 27,702,733 D30N probably damaging Het
Pbld2 A T 10: 63,024,589 probably benign Het
Pcnx4 C T 12: 72,566,976 T565I probably damaging Het
Pdzk1 A T 3: 96,855,930 T225S probably benign Het
Phyhip T G 14: 70,467,199 I286S probably benign Het
Pkd1 T A 17: 24,594,112 Y3903N probably damaging Het
Plcb3 A T 19: 6,965,330 L222Q probably damaging Het
Plcd4 T A 1: 74,554,503 H262Q probably benign Het
Plekhh1 C T 12: 79,062,616 A474V probably benign Het
Plppr3 T C 10: 79,865,703 E435G probably damaging Het
Poln T A 5: 34,118,996 N305I possibly damaging Het
Pou3f2 T C 4: 22,486,874 T420A probably benign Het
Ppdpf T C 2: 181,187,730 Y17H probably damaging Het
Prrx2 C A 2: 30,878,473 T104K probably damaging Het
Ptprj A T 2: 90,464,478 L462H probably benign Het
Radil T C 5: 142,485,549 T991A probably damaging Het
Rbsn T C 6: 92,201,627 E147G probably damaging Het
Ror2 C T 13: 53,146,706 V35M probably benign Het
Rps6ka1 T C 4: 133,872,062 Q18R probably benign Het
Setbp1 T A 18: 78,859,519 D311V possibly damaging Het
Setd2 C T 9: 110,548,797 S560L possibly damaging Het
Svil A G 18: 5,116,080 D2035G probably damaging Het
Syngap1 T C 17: 26,960,011 Y665H probably damaging Het
Tbc1d9b T C 11: 50,152,692 Y547H possibly damaging Het
Tgm2 A G 2: 158,138,892 V83A probably benign Het
Tmem233 T C 5: 116,051,370 I117V probably benign Het
Tsen34 A G 7: 3,700,641 T293A probably damaging Het
Ttn A G 2: 76,878,679 V8752A unknown Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Uchl4 T C 9: 64,235,339 V34A probably damaging Het
Ugt2a2 C T 5: 87,460,576 R468H probably benign Het
Vmn2r102 A T 17: 19,677,487 T255S probably benign Het
Wdr6 T A 9: 108,573,365 N988I probably damaging Het
Wnk1 A T 6: 119,926,428 I2359N unknown Het
Ybey A G 10: 76,468,191 V59A probably benign Het
Zfp397 A G 18: 23,957,065 N142S probably benign Het
Zfy1 A T Y: 725,788 V659E probably damaging Het
Other mutations in Slc12a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Slc12a5 APN 2 164997121 missense probably damaging 1.00
IGL00425:Slc12a5 APN 2 164983281 missense probably damaging 1.00
IGL00976:Slc12a5 APN 2 164979304 missense probably damaging 1.00
IGL01654:Slc12a5 APN 2 164973755 missense possibly damaging 0.91
IGL01905:Slc12a5 APN 2 164990381 missense probably benign 0.02
IGL02205:Slc12a5 APN 2 164996479 missense probably benign 0.03
IGL02510:Slc12a5 APN 2 164982808 splice site probably benign
IGL02746:Slc12a5 APN 2 164974916 missense probably benign 0.01
R0051:Slc12a5 UTSW 2 164986663 missense probably damaging 1.00
R0254:Slc12a5 UTSW 2 164997245 critical splice donor site probably null
R0412:Slc12a5 UTSW 2 164994062 missense probably benign 0.05
R0587:Slc12a5 UTSW 2 164976533 missense probably damaging 1.00
R0835:Slc12a5 UTSW 2 164994038 missense probably damaging 0.97
R0932:Slc12a5 UTSW 2 164996885 splice site probably benign
R1643:Slc12a5 UTSW 2 164994027 missense probably benign 0.01
R1700:Slc12a5 UTSW 2 164992376 missense possibly damaging 0.94
R1760:Slc12a5 UTSW 2 164996128 missense probably damaging 0.99
R2063:Slc12a5 UTSW 2 164997147 missense probably damaging 1.00
R2293:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R2412:Slc12a5 UTSW 2 164976462 critical splice donor site probably null
R3035:Slc12a5 UTSW 2 164980258 missense probably benign 0.06
R3116:Slc12a5 UTSW 2 164996181 splice site probably null
R3412:Slc12a5 UTSW 2 164968431 missense probably benign 0.26
R3788:Slc12a5 UTSW 2 164993775 missense probably damaging 1.00
R4039:Slc12a5 UTSW 2 164992330 missense probably benign 0.03
R4174:Slc12a5 UTSW 2 164979490 missense probably damaging 1.00
R4492:Slc12a5 UTSW 2 164979343 missense probably benign 0.08
R4608:Slc12a5 UTSW 2 164973765 missense probably damaging 0.99
R4750:Slc12a5 UTSW 2 164982931 missense probably benign 0.06
R4994:Slc12a5 UTSW 2 164983365 splice site probably null
R5103:Slc12a5 UTSW 2 164992433 missense probably damaging 1.00
R5539:Slc12a5 UTSW 2 164987206 missense possibly damaging 0.94
R5632:Slc12a5 UTSW 2 164987221 missense possibly damaging 0.86
R5771:Slc12a5 UTSW 2 164973768 missense possibly damaging 0.88
R6139:Slc12a5 UTSW 2 164992311 missense probably damaging 0.98
R6336:Slc12a5 UTSW 2 164992464 splice site probably null
R6581:Slc12a5 UTSW 2 164987115 missense probably damaging 1.00
R6706:Slc12a5 UTSW 2 164988589 missense probably damaging 1.00
R6886:Slc12a5 UTSW 2 164982905 missense probably benign
R7310:Slc12a5 UTSW 2 164992440 missense probably damaging 1.00
R7402:Slc12a5 UTSW 2 164982932 missense probably benign 0.01
R8079:Slc12a5 UTSW 2 164992452 missense probably damaging 1.00
R8301:Slc12a5 UTSW 2 164993691 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCATGTGAGAACCTGGGG -3'
(R):5'- AAGCTCAGGTCGCATGCT -3'

Sequencing Primer
(F):5'- CATGTGAGAACCTGGGGGAAGAG -3'
(R):5'- AGGTCGCATGCTTCCCC -3'
Posted On2019-05-15