Incidental Mutation 'R0600:Cep135'
ID 55290
Institutional Source Beutler Lab
Gene Symbol Cep135
Ensembl Gene ENSMUSG00000036403
Gene Name centrosomal protein 135
Synonyms Cep4, LOC381644
MMRRC Submission 038789-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0600 (G1)
Quality Score 132
Status Validated
Chromosome 5
Chromosomal Location 76736545-76794313 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 76769152 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 601 (V601L)
Ref Sequence ENSEMBL: ENSMUSP00000112602 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049060] [ENSMUST00000121979]
AlphaFold Q6P5D4
Predicted Effect probably benign
Transcript: ENSMUST00000049060
AA Change: V601L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038674
Gene: ENSMUSG00000036403
AA Change: V601L

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121979
AA Change: V601L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112602
Gene: ENSMUSG00000036403
AA Change: V601L

DomainStartEndE-ValueType
internal_repeat_1 47 71 1.87e-5 PROSPERO
low complexity region 78 92 N/A INTRINSIC
internal_repeat_1 100 124 1.87e-5 PROSPERO
coiled coil region 125 153 N/A INTRINSIC
coiled coil region 194 245 N/A INTRINSIC
coiled coil region 267 420 N/A INTRINSIC
coiled coil region 445 470 N/A INTRINSIC
Blast:HAMP 492 527 5e-11 BLAST
Blast:SPEC 760 863 6e-21 BLAST
low complexity region 1060 1072 N/A INTRINSIC
coiled coil region 1075 1117 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130651
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein, which acts as a scaffolding protein during early centriole biogenesis, and is also required for centriole-centriole cohesion during interphase. Mutations in this gene are associated with autosomal recessive primary microcephaly-8. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 130,959,389 (GRCm39) S150P probably damaging Het
5530400C23Rik T G 6: 133,270,174 (GRCm39) probably benign Het
Ahctf1 A C 1: 179,591,033 (GRCm39) probably null Het
Ang5 T C 14: 44,200,206 (GRCm39) V90A probably benign Het
Ano9 C T 7: 140,684,623 (GRCm39) G442R probably damaging Het
Apaf1 G A 10: 90,895,914 (GRCm39) T386I probably damaging Het
Apob C A 12: 8,056,440 (GRCm39) H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 (GRCm39) probably benign Het
Asxl1 T A 2: 153,241,824 (GRCm39) D791E probably benign Het
Avl9 T C 6: 56,713,891 (GRCm39) V383A probably benign Het
Btbd1 A C 7: 81,465,754 (GRCm39) D197E probably damaging Het
Camta2 T C 11: 70,564,785 (GRCm39) I938V possibly damaging Het
Ccn5 G A 2: 163,667,233 (GRCm39) C78Y probably damaging Het
Cdca7 C A 2: 72,313,811 (GRCm39) A200D possibly damaging Het
Cep104 A T 4: 154,091,249 (GRCm39) Y923F possibly damaging Het
Ces2b G A 8: 105,562,542 (GRCm39) G291S probably benign Het
Col6a6 C T 9: 105,638,639 (GRCm39) G1400D probably damaging Het
Cyth2 T C 7: 45,462,541 (GRCm39) E1G probably damaging Het
Dand5 A T 8: 85,542,921 (GRCm39) L185Q probably damaging Het
Dck T C 5: 88,929,080 (GRCm39) V253A probably benign Het
Ddx20 A G 3: 105,586,396 (GRCm39) S650P probably damaging Het
Dicer1 G A 12: 104,673,123 (GRCm39) P799S probably damaging Het
Dst C T 1: 34,228,200 (GRCm39) P1606L probably damaging Het
Eya2 G A 2: 165,611,157 (GRCm39) C477Y probably damaging Het
Fip1l1 T A 5: 74,756,503 (GRCm39) N498K probably damaging Het
Flt4 C T 11: 49,527,166 (GRCm39) probably benign Het
Galntl6 T C 8: 58,290,217 (GRCm39) probably null Het
Gda A T 19: 21,411,667 (GRCm39) F44I possibly damaging Het
Gli2 G A 1: 118,768,119 (GRCm39) R703C probably damaging Het
Golgb1 T A 16: 36,736,633 (GRCm39) L1960Q probably damaging Het
Gramd1b T C 9: 40,219,651 (GRCm39) D341G probably damaging Het
Grid2 G T 6: 63,480,419 (GRCm39) A78S probably benign Het
Hao2 A T 3: 98,790,876 (GRCm39) probably benign Het
Hook3 A G 8: 26,609,014 (GRCm39) V10A probably benign Het
Kif20a A G 18: 34,762,262 (GRCm39) E425G probably damaging Het
Lrp1 T C 10: 127,403,252 (GRCm39) D2107G probably benign Het
Lrriq3 T C 3: 154,893,373 (GRCm39) I358T possibly damaging Het
Mad2l2 A G 4: 148,225,381 (GRCm39) D17G possibly damaging Het
Mastl G T 2: 23,023,358 (GRCm39) T455K probably benign Het
Mkln1 G T 6: 31,409,862 (GRCm39) probably benign Het
Mmp1b A T 9: 7,387,947 (GRCm39) Y16N possibly damaging Het
Mmp24 C T 2: 155,634,517 (GRCm39) A79V probably benign Het
Mrps35 T A 6: 146,972,232 (GRCm39) C292S possibly damaging Het
Myom1 T C 17: 71,427,643 (GRCm39) F1435L possibly damaging Het
Nars2 C T 7: 96,689,130 (GRCm39) H351Y probably damaging Het
Nat2 A T 8: 67,953,919 (GRCm39) I10F probably damaging Het
Nfix G A 8: 85,453,155 (GRCm39) R300C probably damaging Het
Olfm5 A T 7: 103,803,076 (GRCm39) Y462* probably null Het
Or13p5 C T 4: 118,591,986 (GRCm39) H87Y probably damaging Het
Or1j12 C A 2: 36,342,660 (GRCm39) A21E probably benign Het
Or2w3 C A 11: 58,556,986 (GRCm39) F200L probably damaging Het
Or4c122 C A 2: 89,079,742 (GRCm39) E87* probably null Het
Or4e1 T C 14: 52,700,966 (GRCm39) I167V probably benign Het
Or5p70 T A 7: 107,994,438 (GRCm39) I37N probably damaging Het
Or7g35 T C 9: 19,496,600 (GRCm39) S256P possibly damaging Het
Or8d2b T A 9: 38,789,111 (GRCm39) I213N probably damaging Het
Or8g20 A T 9: 39,396,284 (GRCm39) F85L probably benign Het
Otog A T 7: 45,900,819 (GRCm39) probably benign Het
Pdcd2l A T 7: 33,892,232 (GRCm39) D212E possibly damaging Het
Pex5 T C 6: 124,381,596 (GRCm39) N213S probably benign Het
Pkn3 C T 2: 29,971,146 (GRCm39) P238S probably benign Het
Pramel32 A T 4: 88,547,536 (GRCm39) I45K probably damaging Het
Prl2b1 A T 13: 27,574,723 (GRCm39) probably null Het
Ptprb A T 10: 116,204,712 (GRCm39) I1849L possibly damaging Het
Rasal3 G T 17: 32,612,500 (GRCm39) S787Y probably damaging Het
Scn2a T A 2: 65,532,177 (GRCm39) D596E possibly damaging Het
Sdhd A T 9: 50,515,064 (GRCm39) V9D possibly damaging Het
Serinc5 T C 13: 92,844,565 (GRCm39) S436P probably damaging Het
Slc27a1 C T 8: 72,036,808 (GRCm39) P348L probably damaging Het
Slc28a2b A T 2: 122,344,879 (GRCm39) I162F probably damaging Het
Smg1 G A 7: 117,759,606 (GRCm39) probably benign Het
Sorl1 A T 9: 41,955,196 (GRCm39) probably benign Het
Sprtn T A 8: 125,626,957 (GRCm39) H112Q probably damaging Het
Tasor2 A T 13: 3,626,054 (GRCm39) F1299I probably benign Het
Tet2 A G 3: 133,173,363 (GRCm39) M1633T probably benign Het
Tet2 T A 3: 133,173,486 (GRCm39) D1592V probably benign Het
Tmem68 A T 4: 3,569,667 (GRCm39) C8S probably damaging Het
Tnrc6a T A 7: 122,771,039 (GRCm39) I943N probably benign Het
Trib2 A T 12: 15,844,069 (GRCm39) V191D probably damaging Het
Tsc22d4 T C 5: 137,760,917 (GRCm39) S113P probably damaging Het
Ttc21b T C 2: 66,069,914 (GRCm39) R250G probably damaging Het
Ubr2 T C 17: 47,278,174 (GRCm39) Y721C probably damaging Het
Ubtfl1 A T 9: 18,320,660 (GRCm39) I63F probably damaging Het
Ush1c G A 7: 45,874,332 (GRCm39) P171S probably benign Het
Utp20 A T 10: 88,603,323 (GRCm39) N1843K probably damaging Het
Vangl1 A G 3: 102,074,253 (GRCm39) Y285H probably damaging Het
Virma A G 4: 11,498,769 (GRCm39) D70G probably damaging Het
Vmn2r102 T C 17: 19,898,277 (GRCm39) F431L probably benign Het
Wdr17 A G 8: 55,114,530 (GRCm39) I662T probably damaging Het
Wdr87-ps T A 7: 29,232,690 (GRCm39) noncoding transcript Het
Zfp160 G A 17: 21,247,268 (GRCm39) R606H probably benign Het
Zfp369 C T 13: 65,444,248 (GRCm39) R464C probably damaging Het
Other mutations in Cep135
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Cep135 APN 5 76,749,306 (GRCm39) missense probably damaging 0.98
IGL01154:Cep135 APN 5 76,754,643 (GRCm39) splice site probably benign
IGL01323:Cep135 APN 5 76,739,612 (GRCm39) missense probably benign 0.29
IGL01599:Cep135 APN 5 76,741,194 (GRCm39) missense possibly damaging 0.93
IGL01923:Cep135 APN 5 76,788,829 (GRCm39) makesense probably null
IGL02178:Cep135 APN 5 76,743,321 (GRCm39) missense probably damaging 1.00
IGL02276:Cep135 APN 5 76,782,093 (GRCm39) missense probably benign 0.00
IGL02344:Cep135 APN 5 76,764,668 (GRCm39) missense probably benign
IGL02394:Cep135 APN 5 76,779,318 (GRCm39) missense probably benign 0.02
IGL02740:Cep135 APN 5 76,786,115 (GRCm39) critical splice donor site probably null
IGL02832:Cep135 APN 5 76,788,796 (GRCm39) missense probably damaging 0.98
R0026:Cep135 UTSW 5 76,754,581 (GRCm39) nonsense probably null
R0060:Cep135 UTSW 5 76,769,197 (GRCm39) missense probably benign 0.20
R0325:Cep135 UTSW 5 76,763,590 (GRCm39) missense probably damaging 0.98
R0336:Cep135 UTSW 5 76,749,349 (GRCm39) missense probably benign 0.07
R0564:Cep135 UTSW 5 76,786,796 (GRCm39) missense probably benign 0.03
R0564:Cep135 UTSW 5 76,763,557 (GRCm39) missense probably damaging 1.00
R0636:Cep135 UTSW 5 76,763,504 (GRCm39) missense probably benign 0.07
R0704:Cep135 UTSW 5 76,778,796 (GRCm39) missense possibly damaging 0.62
R0835:Cep135 UTSW 5 76,763,553 (GRCm39) missense probably benign 0.40
R1015:Cep135 UTSW 5 76,788,844 (GRCm39) critical splice donor site probably null
R1167:Cep135 UTSW 5 76,772,484 (GRCm39) missense probably damaging 1.00
R1252:Cep135 UTSW 5 76,741,962 (GRCm39) missense possibly damaging 0.67
R1554:Cep135 UTSW 5 76,782,060 (GRCm39) nonsense probably null
R1770:Cep135 UTSW 5 76,751,042 (GRCm39) missense possibly damaging 0.95
R1804:Cep135 UTSW 5 76,784,779 (GRCm39) missense probably benign 0.22
R1968:Cep135 UTSW 5 76,772,594 (GRCm39) missense possibly damaging 0.96
R1987:Cep135 UTSW 5 76,745,275 (GRCm39) missense probably benign 0.00
R1996:Cep135 UTSW 5 76,780,113 (GRCm39) missense probably benign 0.08
R2004:Cep135 UTSW 5 76,780,176 (GRCm39) critical splice donor site probably null
R2178:Cep135 UTSW 5 76,779,297 (GRCm39) missense probably benign 0.00
R2305:Cep135 UTSW 5 76,743,236 (GRCm39) splice site probably benign
R2679:Cep135 UTSW 5 76,772,507 (GRCm39) missense probably benign
R3125:Cep135 UTSW 5 76,769,210 (GRCm39) critical splice donor site probably null
R3623:Cep135 UTSW 5 76,772,586 (GRCm39) missense probably benign 0.00
R4359:Cep135 UTSW 5 76,759,561 (GRCm39) missense possibly damaging 0.47
R4407:Cep135 UTSW 5 76,772,514 (GRCm39) missense probably benign
R4561:Cep135 UTSW 5 76,786,040 (GRCm39) missense possibly damaging 0.95
R4666:Cep135 UTSW 5 76,764,701 (GRCm39) missense probably benign
R4945:Cep135 UTSW 5 76,745,275 (GRCm39) missense probably benign 0.00
R5105:Cep135 UTSW 5 76,741,939 (GRCm39) missense probably benign 0.00
R5117:Cep135 UTSW 5 76,779,276 (GRCm39) missense probably benign 0.01
R5176:Cep135 UTSW 5 76,784,873 (GRCm39) missense probably benign 0.04
R5194:Cep135 UTSW 5 76,763,624 (GRCm39) missense probably benign 0.05
R5233:Cep135 UTSW 5 76,739,690 (GRCm39) small deletion probably benign
R5275:Cep135 UTSW 5 76,741,051 (GRCm39) missense possibly damaging 0.94
R5295:Cep135 UTSW 5 76,741,051 (GRCm39) missense possibly damaging 0.94
R5412:Cep135 UTSW 5 76,764,709 (GRCm39) missense probably benign 0.00
R5427:Cep135 UTSW 5 76,786,049 (GRCm39) missense probably benign 0.00
R5801:Cep135 UTSW 5 76,778,523 (GRCm39) missense probably damaging 1.00
R5975:Cep135 UTSW 5 76,788,737 (GRCm39) missense possibly damaging 0.94
R6087:Cep135 UTSW 5 76,763,638 (GRCm39) critical splice donor site probably null
R6176:Cep135 UTSW 5 76,772,490 (GRCm39) missense probably benign
R6210:Cep135 UTSW 5 76,772,570 (GRCm39) missense probably benign 0.15
R6456:Cep135 UTSW 5 76,739,571 (GRCm39) start gained probably benign
R6467:Cep135 UTSW 5 76,769,187 (GRCm39) missense possibly damaging 0.50
R6622:Cep135 UTSW 5 76,788,815 (GRCm39) missense probably benign 0.00
R6650:Cep135 UTSW 5 76,781,548 (GRCm39) missense possibly damaging 0.77
R6838:Cep135 UTSW 5 76,780,062 (GRCm39) missense probably damaging 1.00
R7028:Cep135 UTSW 5 76,764,695 (GRCm39) missense probably benign
R7049:Cep135 UTSW 5 76,754,585 (GRCm39) missense probably benign 0.01
R7095:Cep135 UTSW 5 76,741,905 (GRCm39) missense probably benign 0.10
R7207:Cep135 UTSW 5 76,780,090 (GRCm39) missense probably benign 0.00
R7330:Cep135 UTSW 5 76,754,592 (GRCm39) nonsense probably null
R7369:Cep135 UTSW 5 76,741,100 (GRCm39) missense possibly damaging 0.94
R7741:Cep135 UTSW 5 76,778,817 (GRCm39) missense probably damaging 0.99
R7850:Cep135 UTSW 5 76,739,720 (GRCm39) critical splice donor site probably null
R7869:Cep135 UTSW 5 76,788,803 (GRCm39) missense probably benign 0.00
R7923:Cep135 UTSW 5 76,757,539 (GRCm39) missense possibly damaging 0.90
R8303:Cep135 UTSW 5 76,759,575 (GRCm39) missense probably damaging 1.00
R8312:Cep135 UTSW 5 76,784,746 (GRCm39) missense probably damaging 1.00
R8424:Cep135 UTSW 5 76,741,906 (GRCm39) missense possibly damaging 0.64
R8490:Cep135 UTSW 5 76,786,054 (GRCm39) missense probably benign 0.00
R8967:Cep135 UTSW 5 76,751,165 (GRCm39) missense probably damaging 1.00
R8968:Cep135 UTSW 5 76,754,576 (GRCm39) missense possibly damaging 0.88
R9126:Cep135 UTSW 5 76,781,550 (GRCm39) missense probably benign 0.08
R9726:Cep135 UTSW 5 76,741,151 (GRCm39) missense probably benign
Z1177:Cep135 UTSW 5 76,739,673 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTGCCTGTTAACCAGGTTCAATC -3'
(R):5'- CTGTAACATTCCAGGACTCCCTTGC -3'

Sequencing Primer
(F):5'- TTCTGCATGACACACAAAGATAGG -3'
(R):5'- AGCGGGATTTGAACCACG -3'
Posted On 2013-07-11