Incidental Mutation 'R7134:Tsen34'
ID552910
Institutional Source Beutler Lab
Gene Symbol Tsen34
Ensembl Gene ENSMUSG00000035585
Gene NametRNA splicing endonuclease subunit 34
SynonymsLeng5, 0610027F08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R7134 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location3692863-3701024 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3700641 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 293 (T293A)
Ref Sequence ENSEMBL: ENSMUSP00000104267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006496] [ENSMUST00000038521] [ENSMUST00000108623] [ENSMUST00000108624] [ENSMUST00000108625] [ENSMUST00000108627] [ENSMUST00000108629] [ENSMUST00000108630] [ENSMUST00000126562] [ENSMUST00000139818] [ENSMUST00000146927] [ENSMUST00000155060] [ENSMUST00000205287]
Predicted Effect probably benign
Transcript: ENSMUST00000006496
SMART Domains Protein: ENSMUSP00000006496
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 1.1e-33 PFAM
S4 108 179 6.84e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000038521
AA Change: T289A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000046911
Gene: ENSMUSG00000035585
AA Change: T289A

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 219 303 2.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108623
SMART Domains Protein: ENSMUSP00000104263
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 6.7e-34 PFAM
Pfam:S4 108 137 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108624
SMART Domains Protein: ENSMUSP00000104264
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 78 4.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108625
SMART Domains Protein: ENSMUSP00000104265
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Ribosomal_S4 3 107 3.47e-16 SMART
S4 108 179 6.84e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108627
AA Change: T293A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104267
Gene: ENSMUSG00000035585
AA Change: T293A

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 4.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108629
AA Change: T264A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104269
Gene: ENSMUSG00000035585
AA Change: T264A

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 256 3.7e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108630
AA Change: T293A

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104270
Gene: ENSMUSG00000035585
AA Change: T293A

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Pfam:tRNA_int_endo 223 307 7.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126562
SMART Domains Protein: ENSMUSP00000120736
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 107 1.3e-33 PFAM
Pfam:S4 108 136 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139818
SMART Domains Protein: ENSMUSP00000114894
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 6 58 2.3e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146927
SMART Domains Protein: ENSMUSP00000116623
Gene: ENSMUSG00000006333

DomainStartEndE-ValueType
Pfam:Ribosomal_S4 2 103 1.3e-33 PFAM
Pfam:S4 104 133 2.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147288
Predicted Effect probably benign
Transcript: ENSMUST00000155060
SMART Domains Protein: ENSMUSP00000118816
Gene: ENSMUSG00000035585

DomainStartEndE-ValueType
low complexity region 45 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205287
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a catalytic subunit of the tRNA splicing endonuclease, which catalyzes the removal of introns from precursor tRNAs. The endonuclease complex is also associated with a pre-mRNA 3-prime end processing factor. A mutation in this gene results in the neurological disorder pontocerebellar hypoplasia type 2. Multiple alternatively spliced variants, encoding the same protein, have been identified.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,959,252 F638S possibly damaging Het
Actl6b T A 5: 137,564,500 N159K probably damaging Het
Adam6a T G 12: 113,545,035 S343A probably benign Het
Ankrd17 G A 5: 90,232,314 T2505I probably damaging Het
Ankrd17 T C 5: 90,285,523 T728A probably benign Het
Asap2 G T 12: 21,265,963 E919* probably null Het
Atp10b A T 11: 43,245,464 I1140F probably damaging Het
Cep126 A T 9: 8,103,382 V209E probably damaging Het
Cfap65 C T 1: 74,926,633 R406Q probably benign Het
Cldn1 T C 16: 26,371,626 M1V probably null Het
Cryl1 C T 14: 57,275,499 D304N probably benign Het
D3Ertd751e T C 3: 41,753,777 probably null Het
D630044L22Rik A T 17: 25,962,116 M156L probably benign Het
Ddx21 T C 10: 62,591,855 D423G possibly damaging Het
Dock2 T A 11: 34,310,363 M993L probably benign Het
Dupd1 A T 14: 21,677,061 I173N probably damaging Het
Eif4g1 C T 16: 20,681,502 A675V probably damaging Het
Eml1 C T 12: 108,506,551 S206L probably benign Het
Farp2 A C 1: 93,603,459 I560L probably benign Het
Fbn1 A T 2: 125,382,049 D593E probably benign Het
Fetub A G 16: 22,929,257 D61G possibly damaging Het
Fpgs T C 2: 32,686,629 K329E probably benign Het
Fpgt T C 3: 155,091,483 Y45C probably damaging Het
Gas2l1 A T 11: 5,061,106 C574* probably null Het
Gm13212 T A 4: 145,622,805 C271S possibly damaging Het
Gm6460 C T 5: 11,597,739 T148I possibly damaging Het
Gm9747 G T 1: 82,234,116 C12F unknown Het
H2-T23 T C 17: 36,031,817 Y143C probably damaging Het
Hhip A T 8: 79,992,513 S462T probably benign Het
Hnf1a C T 5: 114,953,387 G416R probably damaging Het
Hoxa5 C T 6: 52,204,043 C103Y probably damaging Het
Kansl3 G T 1: 36,351,767 D395E possibly damaging Het
March10 A G 11: 105,408,676 S116P probably benign Het
Med12l C T 3: 59,093,759 Q748* probably null Het
Mroh7 T A 4: 106,720,594 N296Y probably damaging Het
Mtbp T G 15: 55,558,565 D61E probably benign Het
Muc5b A T 7: 141,857,654 I1446L unknown Het
Myh15 T C 16: 49,081,342 V266A possibly damaging Het
Nap1l1 G A 10: 111,494,794 probably null Het
Napsa A G 7: 44,585,735 T315A probably benign Het
Nlrc5 A T 8: 94,479,722 I734F probably damaging Het
Nnt A G 13: 119,394,662 V183A probably damaging Het
Nploc4 A T 11: 120,385,788 D477E probably benign Het
Nrip3 A G 7: 109,765,488 S144P probably damaging Het
Ntng1 A T 3: 109,935,129 F109L probably benign Het
Olfr110 T A 17: 37,498,885 V78D probably damaging Het
Olfr303 G A 7: 86,395,544 probably benign Het
Olfr485 A G 7: 108,159,676 Y66H probably damaging Het
Olfr883 A G 9: 38,026,499 E231G probably benign Het
Pacsin1 G A 17: 27,702,733 D30N probably damaging Het
Pbld2 A T 10: 63,024,589 probably benign Het
Pcnx4 C T 12: 72,566,976 T565I probably damaging Het
Pdzk1 A T 3: 96,855,930 T225S probably benign Het
Phyhip T G 14: 70,467,199 I286S probably benign Het
Pkd1 T A 17: 24,594,112 Y3903N probably damaging Het
Plcb3 A T 19: 6,965,330 L222Q probably damaging Het
Plcd4 T A 1: 74,554,503 H262Q probably benign Het
Plekhh1 C T 12: 79,062,616 A474V probably benign Het
Plppr3 T C 10: 79,865,703 E435G probably damaging Het
Poln T A 5: 34,118,996 N305I possibly damaging Het
Pou3f2 T C 4: 22,486,874 T420A probably benign Het
Ppdpf T C 2: 181,187,730 Y17H probably damaging Het
Prrx2 C A 2: 30,878,473 T104K probably damaging Het
Ptprj A T 2: 90,464,478 L462H probably benign Het
Radil T C 5: 142,485,549 T991A probably damaging Het
Rbsn T C 6: 92,201,627 E147G probably damaging Het
Ror2 C T 13: 53,146,706 V35M probably benign Het
Rps6ka1 T C 4: 133,872,062 Q18R probably benign Het
Setbp1 T A 18: 78,859,519 D311V possibly damaging Het
Setd2 C T 9: 110,548,797 S560L possibly damaging Het
Slc12a5 A T 2: 164,974,958 I134F probably damaging Het
Svil A G 18: 5,116,080 D2035G probably damaging Het
Syngap1 T C 17: 26,960,011 Y665H probably damaging Het
Tbc1d9b T C 11: 50,152,692 Y547H possibly damaging Het
Tgm2 A G 2: 158,138,892 V83A probably benign Het
Tmem233 T C 5: 116,051,370 I117V probably benign Het
Ttn A G 2: 76,878,679 V8752A unknown Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Uchl4 T C 9: 64,235,339 V34A probably damaging Het
Ugt2a2 C T 5: 87,460,576 R468H probably benign Het
Vmn2r102 A T 17: 19,677,487 T255S probably benign Het
Wdr6 T A 9: 108,573,365 N988I probably damaging Het
Wnk1 A T 6: 119,926,428 I2359N unknown Het
Ybey A G 10: 76,468,191 V59A probably benign Het
Zfp397 A G 18: 23,957,065 N142S probably benign Het
Zfy1 A T Y: 725,788 V659E probably damaging Het
Other mutations in Tsen34
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Tsen34 APN 7 3700531 makesense probably null
R1612:Tsen34 UTSW 7 3695396 missense probably damaging 0.99
R2441:Tsen34 UTSW 7 3694995 missense possibly damaging 0.92
R4455:Tsen34 UTSW 7 3695098 unclassified probably null
R4702:Tsen34 UTSW 7 3700633 missense probably damaging 1.00
R4870:Tsen34 UTSW 7 3694381 unclassified probably benign
R5950:Tsen34 UTSW 7 3694788 missense probably null 0.97
R6221:Tsen34 UTSW 7 3695544 missense probably damaging 0.99
R6266:Tsen34 UTSW 7 3693985 unclassified probably benign
R7121:Tsen34 UTSW 7 3694987 missense probably benign 0.18
R7190:Tsen34 UTSW 7 3694807 missense possibly damaging 0.94
R7345:Tsen34 UTSW 7 3695615 missense probably damaging 1.00
R7448:Tsen34 UTSW 7 3695835 critical splice donor site probably null
R7743:Tsen34 UTSW 7 3694602 missense possibly damaging 0.54
R7887:Tsen34 UTSW 7 3694708 missense probably damaging 1.00
R7970:Tsen34 UTSW 7 3694708 missense probably damaging 1.00
RF020:Tsen34 UTSW 7 3695796 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAACAGTGCAGTAAGCCCAAGG -3'
(R):5'- AGGATGTAGTGTTCAAAACCCTG -3'

Sequencing Primer
(F):5'- AGGCCCCCATGTCAGATCTC -3'
(R):5'- TGTTCAAAACCCTGGAATCGG -3'
Posted On2019-05-15