Incidental Mutation 'R7134:Myh15'
ID552948
Institutional Source Beutler Lab
Gene Symbol Myh15
Ensembl Gene ENSMUSG00000092009
Gene Namemyosin, heavy chain 15
SynonymsEG667772
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R7134 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location49057486-49199104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49081342 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 266 (V266A)
Ref Sequence ENSEMBL: ENSMUSP00000127539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168680]
Predicted Effect possibly damaging
Transcript: ENSMUST00000168680
AA Change: V266A

PolyPhen 2 Score 0.860 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127539
Gene: ENSMUSG00000092009
AA Change: V266A

DomainStartEndE-ValueType
Pfam:Myosin_N 30 70 5.2e-12 PFAM
MYSc 76 770 N/A SMART
Pfam:Myosin_tail_1 836 1915 9.5e-118 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (84/85)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,959,252 F638S possibly damaging Het
Actl6b T A 5: 137,564,500 N159K probably damaging Het
Adam6a T G 12: 113,545,035 S343A probably benign Het
Ankrd17 G A 5: 90,232,314 T2505I probably damaging Het
Ankrd17 T C 5: 90,285,523 T728A probably benign Het
Asap2 G T 12: 21,265,963 E919* probably null Het
Atp10b A T 11: 43,245,464 I1140F probably damaging Het
Cep126 A T 9: 8,103,382 V209E probably damaging Het
Cfap65 C T 1: 74,926,633 R406Q probably benign Het
Cldn1 T C 16: 26,371,626 M1V probably null Het
Cryl1 C T 14: 57,275,499 D304N probably benign Het
D3Ertd751e T C 3: 41,753,777 probably null Het
D630044L22Rik A T 17: 25,962,116 M156L probably benign Het
Ddx21 T C 10: 62,591,855 D423G possibly damaging Het
Dock2 T A 11: 34,310,363 M993L probably benign Het
Dupd1 A T 14: 21,677,061 I173N probably damaging Het
Eif4g1 C T 16: 20,681,502 A675V probably damaging Het
Eml1 C T 12: 108,506,551 S206L probably benign Het
Farp2 A C 1: 93,603,459 I560L probably benign Het
Fbn1 A T 2: 125,382,049 D593E probably benign Het
Fetub A G 16: 22,929,257 D61G possibly damaging Het
Fpgs T C 2: 32,686,629 K329E probably benign Het
Fpgt T C 3: 155,091,483 Y45C probably damaging Het
Gas2l1 A T 11: 5,061,106 C574* probably null Het
Gm13212 T A 4: 145,622,805 C271S possibly damaging Het
Gm6460 C T 5: 11,597,739 T148I possibly damaging Het
Gm9747 G T 1: 82,234,116 C12F unknown Het
H2-T23 T C 17: 36,031,817 Y143C probably damaging Het
Hhip A T 8: 79,992,513 S462T probably benign Het
Hnf1a C T 5: 114,953,387 G416R probably damaging Het
Hoxa5 C T 6: 52,204,043 C103Y probably damaging Het
Kansl3 G T 1: 36,351,767 D395E possibly damaging Het
March10 A G 11: 105,408,676 S116P probably benign Het
Med12l C T 3: 59,093,759 Q748* probably null Het
Mroh7 T A 4: 106,720,594 N296Y probably damaging Het
Mtbp T G 15: 55,558,565 D61E probably benign Het
Muc5b A T 7: 141,857,654 I1446L unknown Het
Nap1l1 G A 10: 111,494,794 probably null Het
Napsa A G 7: 44,585,735 T315A probably benign Het
Nlrc5 A T 8: 94,479,722 I734F probably damaging Het
Nnt A G 13: 119,394,662 V183A probably damaging Het
Nploc4 A T 11: 120,385,788 D477E probably benign Het
Nrip3 A G 7: 109,765,488 S144P probably damaging Het
Ntng1 A T 3: 109,935,129 F109L probably benign Het
Olfr110 T A 17: 37,498,885 V78D probably damaging Het
Olfr303 G A 7: 86,395,544 probably benign Het
Olfr485 A G 7: 108,159,676 Y66H probably damaging Het
Olfr883 A G 9: 38,026,499 E231G probably benign Het
Pacsin1 G A 17: 27,702,733 D30N probably damaging Het
Pbld2 A T 10: 63,024,589 probably benign Het
Pcnx4 C T 12: 72,566,976 T565I probably damaging Het
Pdzk1 A T 3: 96,855,930 T225S probably benign Het
Phyhip T G 14: 70,467,199 I286S probably benign Het
Pkd1 T A 17: 24,594,112 Y3903N probably damaging Het
Plcb3 A T 19: 6,965,330 L222Q probably damaging Het
Plcd4 T A 1: 74,554,503 H262Q probably benign Het
Plekhh1 C T 12: 79,062,616 A474V probably benign Het
Plppr3 T C 10: 79,865,703 E435G probably damaging Het
Poln T A 5: 34,118,996 N305I possibly damaging Het
Pou3f2 T C 4: 22,486,874 T420A probably benign Het
Ppdpf T C 2: 181,187,730 Y17H probably damaging Het
Prrx2 C A 2: 30,878,473 T104K probably damaging Het
Ptprj A T 2: 90,464,478 L462H probably benign Het
Radil T C 5: 142,485,549 T991A probably damaging Het
Rbsn T C 6: 92,201,627 E147G probably damaging Het
Ror2 C T 13: 53,146,706 V35M probably benign Het
Rps6ka1 T C 4: 133,872,062 Q18R probably benign Het
Setbp1 T A 18: 78,859,519 D311V possibly damaging Het
Setd2 C T 9: 110,548,797 S560L possibly damaging Het
Slc12a5 A T 2: 164,974,958 I134F probably damaging Het
Svil A G 18: 5,116,080 D2035G probably damaging Het
Syngap1 T C 17: 26,960,011 Y665H probably damaging Het
Tbc1d9b T C 11: 50,152,692 Y547H possibly damaging Het
Tgm2 A G 2: 158,138,892 V83A probably benign Het
Tmem233 T C 5: 116,051,370 I117V probably benign Het
Tsen34 A G 7: 3,700,641 T293A probably damaging Het
Ttn A G 2: 76,878,679 V8752A unknown Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Uchl4 T C 9: 64,235,339 V34A probably damaging Het
Ugt2a2 C T 5: 87,460,576 R468H probably benign Het
Vmn2r102 A T 17: 19,677,487 T255S probably benign Het
Wdr6 T A 9: 108,573,365 N988I probably damaging Het
Wnk1 A T 6: 119,926,428 I2359N unknown Het
Ybey A G 10: 76,468,191 V59A probably benign Het
Zfp397 A G 18: 23,957,065 N142S probably benign Het
Zfy1 A T Y: 725,788 V659E probably damaging Het
Other mutations in Myh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Myh15 APN 16 49165813 missense probably damaging 0.98
IGL01095:Myh15 APN 16 49132015 missense probably damaging 1.00
IGL01343:Myh15 APN 16 49155677 missense probably benign 0.09
IGL01474:Myh15 APN 16 49132098 missense probably damaging 1.00
IGL01572:Myh15 APN 16 49100222 missense possibly damaging 0.55
IGL01595:Myh15 APN 16 49172949 missense probably damaging 1.00
IGL01632:Myh15 APN 16 49061511 missense probably benign 0.00
IGL01638:Myh15 APN 16 49069480 missense probably damaging 1.00
IGL01667:Myh15 APN 16 49195579 missense probably benign 0.20
IGL01715:Myh15 APN 16 49057484 unclassified probably benign
IGL01833:Myh15 APN 16 49114058 missense probably damaging 1.00
IGL02004:Myh15 APN 16 49110529 splice site probably benign
IGL02033:Myh15 APN 16 49145344 missense probably benign 0.05
IGL02148:Myh15 APN 16 49116315 missense probably damaging 1.00
IGL02225:Myh15 APN 16 49091163 missense probably benign 0.14
IGL02249:Myh15 APN 16 49110484 missense probably damaging 0.99
IGL02505:Myh15 APN 16 49117263 missense possibly damaging 0.90
IGL02622:Myh15 APN 16 49176954 missense probably benign 0.02
IGL02814:Myh15 APN 16 49145438 splice site probably benign
IGL02869:Myh15 APN 16 49145404 missense probably benign
IGL02879:Myh15 APN 16 49173059 missense possibly damaging 0.68
IGL02881:Myh15 APN 16 49117265 missense possibly damaging 0.51
IGL03077:Myh15 APN 16 49096538 missense probably benign 0.10
IGL03354:Myh15 APN 16 49172010 missense probably benign 0.01
IGL03411:Myh15 APN 16 49159967 missense possibly damaging 0.58
ANU74:Myh15 UTSW 16 49172932 missense possibly damaging 0.58
P0027:Myh15 UTSW 16 49081208 missense possibly damaging 0.77
PIT1430001:Myh15 UTSW 16 49196891 critical splice donor site probably null
R0017:Myh15 UTSW 16 49163060 missense probably damaging 0.97
R0038:Myh15 UTSW 16 49071141 splice site probably benign
R0149:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0361:Myh15 UTSW 16 49114005 missense probably benign 0.01
R0373:Myh15 UTSW 16 49182959 missense possibly damaging 0.86
R0433:Myh15 UTSW 16 49145236 missense probably damaging 1.00
R0525:Myh15 UTSW 16 49132051 missense probably benign 0.03
R0586:Myh15 UTSW 16 49171887 splice site probably benign
R0601:Myh15 UTSW 16 49061581 missense probably damaging 1.00
R0717:Myh15 UTSW 16 49142993 missense probably benign 0.03
R0963:Myh15 UTSW 16 49132149 missense probably damaging 0.97
R1075:Myh15 UTSW 16 49120054 missense possibly damaging 0.63
R1143:Myh15 UTSW 16 49065086 missense probably benign 0.02
R1200:Myh15 UTSW 16 49096519 missense probably damaging 1.00
R1644:Myh15 UTSW 16 49132203 missense probably benign 0.12
R1646:Myh15 UTSW 16 49195568 missense probably damaging 1.00
R1720:Myh15 UTSW 16 49092782 missense probably damaging 1.00
R1768:Myh15 UTSW 16 49163135 missense probably benign 0.27
R1881:Myh15 UTSW 16 49071083 missense probably damaging 0.98
R2048:Myh15 UTSW 16 49155565 missense probably damaging 0.99
R2064:Myh15 UTSW 16 49155621 missense possibly damaging 0.50
R2184:Myh15 UTSW 16 49137511 missense probably damaging 0.99
R2212:Myh15 UTSW 16 49138732 missense probably benign 0.02
R2216:Myh15 UTSW 16 49165838 nonsense probably null
R2321:Myh15 UTSW 16 49113073 missense possibly damaging 0.93
R2327:Myh15 UTSW 16 49142950 missense probably benign 0.01
R2395:Myh15 UTSW 16 49069514 missense probably benign 0.04
R2399:Myh15 UTSW 16 49137589 missense probably damaging 0.97
R3413:Myh15 UTSW 16 49138732 missense probably benign 0.02
R4234:Myh15 UTSW 16 49163042 missense probably benign 0.04
R4382:Myh15 UTSW 16 49142943 missense probably benign 0.03
R4421:Myh15 UTSW 16 49109344 missense probably damaging 0.99
R4580:Myh15 UTSW 16 49065025 missense possibly damaging 0.93
R4657:Myh15 UTSW 16 49172058 nonsense probably null
R4780:Myh15 UTSW 16 49120057 missense probably benign 0.13
R5004:Myh15 UTSW 16 49132048 missense probably damaging 0.99
R5175:Myh15 UTSW 16 49069426 missense possibly damaging 0.85
R5189:Myh15 UTSW 16 49101507 missense probably benign 0.20
R5311:Myh15 UTSW 16 49165841 missense possibly damaging 0.94
R5318:Myh15 UTSW 16 49110471 missense probably damaging 0.99
R5404:Myh15 UTSW 16 49159978 missense probably benign 0.15
R5415:Myh15 UTSW 16 49117295 missense probably null 1.00
R5558:Myh15 UTSW 16 49069537 missense probably benign 0.32
R5977:Myh15 UTSW 16 49153503 missense probably damaging 1.00
R6004:Myh15 UTSW 16 49159699 missense probably benign 0.00
R6275:Myh15 UTSW 16 49145247 missense probably benign 0.00
R6381:Myh15 UTSW 16 49101481 missense probably damaging 1.00
R6448:Myh15 UTSW 16 49171932 missense probably damaging 0.99
R6516:Myh15 UTSW 16 49137633 missense probably benign 0.19
R6752:Myh15 UTSW 16 49182927 missense probably damaging 1.00
R6847:Myh15 UTSW 16 49145088 missense possibly damaging 0.70
R6868:Myh15 UTSW 16 49069403 missense probably damaging 1.00
R6889:Myh15 UTSW 16 49153111 missense possibly damaging 0.75
R6896:Myh15 UTSW 16 49113071 missense probably benign 0.44
R6955:Myh15 UTSW 16 49081235 critical splice donor site probably null
R6984:Myh15 UTSW 16 49110412 missense probably damaging 1.00
R7046:Myh15 UTSW 16 49109299 nonsense probably null
R7095:Myh15 UTSW 16 49171909 missense possibly damaging 0.90
R7098:Myh15 UTSW 16 49177057 missense possibly damaging 0.53
R7159:Myh15 UTSW 16 49061574 missense probably damaging 0.97
R7244:Myh15 UTSW 16 49196786 missense probably damaging 1.00
R7278:Myh15 UTSW 16 49091105 missense probably damaging 0.98
R7309:Myh15 UTSW 16 49096465 missense probably benign 0.34
R7327:Myh15 UTSW 16 49173006 missense possibly damaging 0.88
R7418:Myh15 UTSW 16 49155537 missense possibly damaging 0.69
R8053:Myh15 UTSW 16 49142939 missense possibly damaging 0.89
X0012:Myh15 UTSW 16 49142978 missense probably damaging 1.00
X0020:Myh15 UTSW 16 49165874 missense probably damaging 1.00
Z1176:Myh15 UTSW 16 49096531 missense probably damaging 0.98
Z1177:Myh15 UTSW 16 49081228 missense probably benign 0.02
Z1177:Myh15 UTSW 16 49155618 missense probably damaging 0.97
Z1177:Myh15 UTSW 16 49159826 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- CATAAGGAGGCCTTTGCAAC -3'
(R):5'- GTGGGATGAATAAACTATGGTCTG -3'

Sequencing Primer
(F):5'- AGGCCTTTGCAACTGCTCAG -3'
(R):5'- TGGTCTGAAAGTACTAAGAGACTTAC -3'
Posted On2019-05-15