Incidental Mutation 'R7134:Setbp1'
ID552959
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene NameSET binding protein 1
SynonymsSeb
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.488) question?
Stock #R7134 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location78750380-79109391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 78859519 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 311 (D311V)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025430
AA Change: D311V

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: D311V

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 A G 17: 35,959,252 F638S possibly damaging Het
Actl6b T A 5: 137,564,500 N159K probably damaging Het
Adam6a T G 12: 113,545,035 S343A probably benign Het
Ankrd17 G A 5: 90,232,314 T2505I probably damaging Het
Ankrd17 T C 5: 90,285,523 T728A probably benign Het
Asap2 G T 12: 21,265,963 E919* probably null Het
Atp10b A T 11: 43,245,464 I1140F probably damaging Het
Cep126 A T 9: 8,103,382 V209E probably damaging Het
Cfap65 C T 1: 74,926,633 R406Q probably benign Het
Cldn1 T C 16: 26,371,626 M1V probably null Het
Cryl1 C T 14: 57,275,499 D304N probably benign Het
D3Ertd751e T C 3: 41,753,777 probably null Het
D630044L22Rik A T 17: 25,962,116 M156L probably benign Het
Ddx21 T C 10: 62,591,855 D423G possibly damaging Het
Dock2 T A 11: 34,310,363 M993L probably benign Het
Dupd1 A T 14: 21,677,061 I173N probably damaging Het
Eif4g1 C T 16: 20,681,502 A675V probably damaging Het
Eml1 C T 12: 108,506,551 S206L probably benign Het
Farp2 A C 1: 93,603,459 I560L probably benign Het
Fbn1 A T 2: 125,382,049 D593E probably benign Het
Fetub A G 16: 22,929,257 D61G possibly damaging Het
Fpgs T C 2: 32,686,629 K329E probably benign Het
Fpgt T C 3: 155,091,483 Y45C probably damaging Het
Gas2l1 A T 11: 5,061,106 C574* probably null Het
Gm13212 T A 4: 145,622,805 C271S possibly damaging Het
Gm6460 C T 5: 11,597,739 T148I possibly damaging Het
Gm9747 G T 1: 82,234,116 C12F unknown Het
H2-T23 T C 17: 36,031,817 Y143C probably damaging Het
Hhip A T 8: 79,992,513 S462T probably benign Het
Hnf1a C T 5: 114,953,387 G416R probably damaging Het
Hoxa5 C T 6: 52,204,043 C103Y probably damaging Het
Kansl3 G T 1: 36,351,767 D395E possibly damaging Het
March10 A G 11: 105,408,676 S116P probably benign Het
Med12l C T 3: 59,093,759 Q748* probably null Het
Mroh7 T A 4: 106,720,594 N296Y probably damaging Het
Mtbp T G 15: 55,558,565 D61E probably benign Het
Muc5b A T 7: 141,857,654 I1446L unknown Het
Myh15 T C 16: 49,081,342 V266A possibly damaging Het
Nap1l1 G A 10: 111,494,794 probably null Het
Napsa A G 7: 44,585,735 T315A probably benign Het
Nlrc5 A T 8: 94,479,722 I734F probably damaging Het
Nnt A G 13: 119,394,662 V183A probably damaging Het
Nploc4 A T 11: 120,385,788 D477E probably benign Het
Nrip3 A G 7: 109,765,488 S144P probably damaging Het
Ntng1 A T 3: 109,935,129 F109L probably benign Het
Olfr110 T A 17: 37,498,885 V78D probably damaging Het
Olfr303 G A 7: 86,395,544 probably benign Het
Olfr485 A G 7: 108,159,676 Y66H probably damaging Het
Olfr883 A G 9: 38,026,499 E231G probably benign Het
Pacsin1 G A 17: 27,702,733 D30N probably damaging Het
Pbld2 A T 10: 63,024,589 probably benign Het
Pcnx4 C T 12: 72,566,976 T565I probably damaging Het
Pdzk1 A T 3: 96,855,930 T225S probably benign Het
Phyhip T G 14: 70,467,199 I286S probably benign Het
Pkd1 T A 17: 24,594,112 Y3903N probably damaging Het
Plcb3 A T 19: 6,965,330 L222Q probably damaging Het
Plcd4 T A 1: 74,554,503 H262Q probably benign Het
Plekhh1 C T 12: 79,062,616 A474V probably benign Het
Plppr3 T C 10: 79,865,703 E435G probably damaging Het
Poln T A 5: 34,118,996 N305I possibly damaging Het
Pou3f2 T C 4: 22,486,874 T420A probably benign Het
Ppdpf T C 2: 181,187,730 Y17H probably damaging Het
Prrx2 C A 2: 30,878,473 T104K probably damaging Het
Ptprj A T 2: 90,464,478 L462H probably benign Het
Radil T C 5: 142,485,549 T991A probably damaging Het
Rbsn T C 6: 92,201,627 E147G probably damaging Het
Ror2 C T 13: 53,146,706 V35M probably benign Het
Rps6ka1 T C 4: 133,872,062 Q18R probably benign Het
Setd2 C T 9: 110,548,797 S560L possibly damaging Het
Slc12a5 A T 2: 164,974,958 I134F probably damaging Het
Svil A G 18: 5,116,080 D2035G probably damaging Het
Syngap1 T C 17: 26,960,011 Y665H probably damaging Het
Tbc1d9b T C 11: 50,152,692 Y547H possibly damaging Het
Tgm2 A G 2: 158,138,892 V83A probably benign Het
Tmem233 T C 5: 116,051,370 I117V probably benign Het
Tsen34 A G 7: 3,700,641 T293A probably damaging Het
Ttn A G 2: 76,878,679 V8752A unknown Het
Ubac1 A G 2: 26,014,962 V88A probably benign Het
Uchl4 T C 9: 64,235,339 V34A probably damaging Het
Ugt2a2 C T 5: 87,460,576 R468H probably benign Het
Vmn2r102 A T 17: 19,677,487 T255S probably benign Het
Wdr6 T A 9: 108,573,365 N988I probably damaging Het
Wnk1 A T 6: 119,926,428 I2359N unknown Het
Ybey A G 10: 76,468,191 V59A probably benign Het
Zfp397 A G 18: 23,957,065 N142S probably benign Het
Zfy1 A T Y: 725,788 V659E probably damaging Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78755679 nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78857770 missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78856777 missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78857410 missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78857299 missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78857473 missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78755710 missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78857374 nonsense probably null
IGL03005:Setbp1 APN 18 78859125 missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78857009 missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78857626 missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78857860 missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78857236 missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78856583 missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78858208 missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78783358 missense probably benign 0.00
R1481:Setbp1 UTSW 18 78783301 missense probably benign 0.01
R1482:Setbp1 UTSW 18 79086835 missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78859912 missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78858592 missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78858467 missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78857398 missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78858362 missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78858544 missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78856720 missense probably benign 0.00
R2851:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2853:Setbp1 UTSW 18 78923996 missense probably benign 0.11
R2941:Setbp1 UTSW 18 78858197 missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78857435 missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78859303 missense probably benign 0.00
R3807:Setbp1 UTSW 18 78783322 missense probably benign 0.01
R4133:Setbp1 UTSW 18 78856991 missense probably benign 0.05
R4287:Setbp1 UTSW 18 78859061 missense probably benign 0.03
R4345:Setbp1 UTSW 18 79086579 missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78859922 missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78856618 missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79086681 missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79086949 missense probably benign 0.00
R4595:Setbp1 UTSW 18 78857516 missense probably benign 0.00
R4817:Setbp1 UTSW 18 78858800 missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78858167 missense probably benign 0.07
R4976:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78856594 missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78857299 missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78857482 missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78857999 missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78856975 missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78858063 missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79086712 missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79086652 missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78857485 missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78856645 missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78856482 unclassified probably null
R5940:Setbp1 UTSW 18 78755488 missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78859240 missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6030:Setbp1 UTSW 18 78857711 missense probably benign 0.02
R6250:Setbp1 UTSW 18 78858002 missense probably benign 0.00
R6256:Setbp1 UTSW 18 78857257 missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78783369 missense probably benign 0.21
R6522:Setbp1 UTSW 18 78857390 missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78859559 missense probably benign 0.00
R6886:Setbp1 UTSW 18 78857500 missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78857839 missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79086855 missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79086960 missense probably benign 0.08
R7215:Setbp1 UTSW 18 78856837 missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78755745 missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78857486 missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78856492 missense probably benign 0.06
R7589:Setbp1 UTSW 18 78856492 missense probably benign 0.01
Z1088:Setbp1 UTSW 18 78859594 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTGACGGAACTGATGCTCTG -3'
(R):5'- CGTGGCTTCCTTTGCAAAG -3'

Sequencing Primer
(F):5'- CGATGCCTCTTGAGCACTG -3'
(R):5'- AGTAGCAAAGACCTGCTC -3'
Posted On2019-05-15