Mutagenetix > Incidental Mutations

Incidental Mutation 'R7135:Crb1'

552969

Institutional Source

Beutler Lab

Gene Symbol

Crb1

Ensembl Gene

ENSMUSG00000063681

Gene Name

crumbs family member 1, photoreceptor morphogenesis associated

Synonyms

7530426H14Rik, A930008G09Rik

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_133239.2; MGI: 2136343

Is this an essential gene?

Possibly non essential (E-score: 0.394) question?

Stock #

R7135 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

139197056-139377100 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 139243367 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 762 (V762F)

Ref Sequence

ENSEMBL: ENSMUSP00000060769 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000059825] [ENSMUST00000196402] [ENSMUST00000198445]

Predicted Effect

probably damaging
Transcript: ENSMUST00000059825
AA Change: V762F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000060769
Gene: ENSMUSG00000063681
AA Change: V762F

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
EGF	72	107	5.97e-4	SMART
EGF	112	145	9.19e-5	SMART
EGF_CA	147	183	2.89e-11	SMART
EGF_CA	185	221	1.14e-9	SMART
EGF_CA	223	259	2.26e-13	SMART
EGF_CA	261	298	5.15e-8	SMART
EGF	303	336	8.12e-6	SMART
EGF	341	394	2.6e-4	SMART
EGF_CA	396	438	2.54e-7	SMART
EGF	443	480	1.47e-3	SMART
LamG	505	650	1.75e-9	SMART
EGF	674	707	6.5e-5	SMART
LamG	734	859	1.05e-7	SMART
EGF	889	922	1.19e-3	SMART
LamG	971	1104	6.85e-12	SMART
EGF	1141	1174	7.07e-6	SMART
EGF_CA	1176	1211	3.01e-9	SMART
EGF	1216	1249	3.57e-2	SMART
EGF	1257	1294	6.92e0	SMART
EGF_CA	1296	1332	4.19e-8	SMART
transmembrane domain	1346	1368	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000196402

SMART Domains

Protein: ENSMUSP00000142702
Gene: ENSMUSG00000063681

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
EGF	72	107	5.97e-4	SMART
EGF	112	145	9.19e-5	SMART
EGF_CA	147	183	2.89e-11	SMART
EGF_CA	185	221	1.14e-9	SMART
EGF_CA	223	259	2.26e-13	SMART
EGF_CA	261	298	5.15e-8	SMART
EGF	303	336	8.12e-6	SMART
EGF	341	394	2.6e-4	SMART
EGF_CA	396	438	2.54e-7	SMART
EGF	443	480	1.47e-3	SMART
LamG	505	650	1.75e-9	SMART
EGF	674	707	6.5e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000198445
AA Change: V701F

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000142552
Gene: ENSMUSG00000063681
AA Change: V701F

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
EGF	72	107	5.97e-4	SMART
EGF	112	145	9.19e-5	SMART
EGF_CA	147	183	2.89e-11	SMART
EGF_CA	185	221	1.14e-9	SMART
EGF_CA	223	259	2.26e-13	SMART
EGF_CA	261	298	5.15e-8	SMART
EGF	303	333	1.63e1	SMART
EGF_CA	335	377	2.54e-7	SMART
EGF	382	419	1.47e-3	SMART
LamG	444	589	1.75e-9	SMART
EGF	613	646	6.5e-5	SMART
LamG	673	798	1.05e-7	SMART
EGF	828	861	1.19e-3	SMART
LamG	910	1043	6.85e-12	SMART
EGF	1080	1113	7.07e-6	SMART
EGF_CA	1115	1150	3.01e-9	SMART
EGF	1155	1188	3.57e-2	SMART
EGF	1196	1233	6.92e0	SMART
EGF_CA	1235	1271	4.19e-8	SMART
low complexity region	1282	1296	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (83/83)

MGI Phenotype

Strain: 3052072; 2676366
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is similar to the Drosophila crumbs protein and localizes to the inner segment of mammalian photoreceptors. In Drosophila crumbs localizes to the stalk of the fly photoreceptor and may be a component of the molecular scaffold that controls proper development of polarity in the eye. Mutations in this gene are associated with a severe form of retinitis pigmentosa, RP12, and with Leber congenital amaurosis. Alternate splicing results in multiple transcript variants, some protein coding and some non-protein coding.[provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygotes for a null allele show focal retinal lesions, loss of adherens junctions between photoreceptors and Muller glia cells, and light-accelerated retinal degeneration. Homozygotes for a spontaneous allele show background-sensitive retinal spotting, photoreceptor dysplasia and degeneration. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted(4) Spontaneous(1)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016G14Rik	T	C	13: 24,741,506	S78P	probably benign	Het
Aars2	T	A	17: 45,508,961	Y221*	probably null	Het
AC166344.1	T	A	14: 43,300,788	F97I		Het
Ankmy2	T	C	12: 36,196,312	S412P	probably benign	Het
Ap1s3	T	C	1: 79,609,202	T144A	probably benign	Het
Asb3	T	A	11: 30,998,501	L59*	probably null	Het
Asxl3	G	T	18: 22,517,701	G916*	probably null	Het
Asxl3	G	C	18: 22,517,702	G916A	probably damaging	Het
Birc2	A	C	9: 7,818,761	F610V	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccdc162	A	G	10: 41,673,859	S343P	probably benign	Het
Ccnk	T	A	12: 108,186,475	L17Q	probably damaging	Het
Cd59b	G	A	2: 104,084,447	W63*	probably null	Het
Chrm3	C	T	13: 9,877,801	V400I	probably benign	Het
Cspp1	C	T	1: 10,088,936	T529I	possibly damaging	Het
Cttnbp2	A	G	6: 18,448,447	I71T	possibly damaging	Het
Cyb561	C	A	11: 105,935,567	G90V	probably damaging	Het
Cyld	T	A	8: 88,744,892	D804E	possibly damaging	Het
Ddx31	G	A	2: 28,848,306	V160I	probably benign	Het
Dgkg	T	C	16: 22,500,382	D643G	probably damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnah12	T	G	14: 26,801,413	I1953S	probably damaging	Het
Dnah7b	T	C	1: 46,139,710	W848R	probably damaging	Het
Dnah7c	C	T	1: 46,533,208	T947M	probably damaging	Het
Dnmt3c	C	A	2: 153,714,952		probably null	Het
Dsp	A	T	13: 38,179,073	Y443F	probably damaging	Het
Espl1	T	A	15: 102,319,524	C1603*	probably null	Het
Faiml	G	T	9: 99,234,443	R65S	probably benign	Het
Gfpt2	T	C	11: 49,804,955	I4T	probably damaging	Het
Gm10376	T	A	14: 43,010,493	M179L	probably benign	Het
Gm13084	A	T	4: 143,810,663	L366Q	probably damaging	Het
Gm4302	T	A	10: 100,341,727	M291K	unknown	Het
Gm8906	C	T	5: 11,505,231	P83S	probably damaging	Het
Gnb1l	T	A	16: 18,545,168	D154E	probably benign	Het
Igkv10-94	T	C	6: 68,704,743	R38G	possibly damaging	Het
Inmt	A	T	6: 55,171,028	Y205*	probably null	Het
Krba1	A	G	6: 48,416,299	Q1049R	probably benign	Het
Lpxn	T	A	19: 12,833,319	C376S	probably damaging	Het
Lrrc52	T	A	1: 167,466,450	I89F	probably damaging	Het
Map9	A	T	3: 82,363,458	T110S	probably benign	Het
Mccc1	T	C	3: 35,995,818	Y75C	probably damaging	Het
Mff	T	A	1: 82,747,091	L203*	probably null	Het
Micall1	C	A	15: 79,109,424	D47E	unknown	Het
Mink1	T	C	11: 70,603,503	F243S	probably damaging	Het
Mlycd	C	T	8: 119,402,477	R228W	probably damaging	Het
Msr1	A	T	8: 39,589,424	V370E	possibly damaging	Het
Naip6	T	C	13: 100,300,419	E532G	probably damaging	Het
Nepn	G	A	10: 52,391,719	C27Y	probably damaging	Het
Ninl	T	C	2: 150,955,604	H592R	probably benign	Het
Nr4a2	A	G	2: 57,112,249	M64T	possibly damaging	Het
Olfr1279	T	A	2: 111,307,020	F272I	probably benign	Het
Olfr484	T	C	7: 108,124,574	K230E	probably damaging	Het
Oprm1	A	T	10: 6,830,203	I171F	possibly damaging	Het
Pcbp1	A	T	6: 86,525,506	M137K	possibly damaging	Het
Pcf11	A	T	7: 92,657,316	S1215T	probably benign	Het
Pdlim5	A	T	3: 142,311,922		probably null	Het
Pecam1	T	C	11: 106,689,031	I402V	probably damaging	Het
Pex12	T	C	11: 83,297,642	T176A	probably benign	Het
Phf3	T	C	1: 30,831,109	K286R	possibly damaging	Het
Pik3ap1	T	A	19: 41,332,321	D153V	probably damaging	Het
Pkhd1l1	T	A	15: 44,584,978		probably null	Het
Plekhn1	A	G	4: 156,223,335	V378A	probably benign	Het
Ptprm	A	T	17: 66,944,288	D531E	possibly damaging	Het
Pum2	A	T	12: 8,728,952	Q508L	possibly damaging	Het
Rad54l	A	G	4: 116,105,830	S324P	probably damaging	Het
Recql5	C	T	11: 115,930,672		probably null	Het
Reln	A	T	5: 21,976,596	V1763D	possibly damaging	Het
Rp1	T	C	1: 4,348,168	N907S	possibly damaging	Het
Scaf11	T	A	15: 96,420,328	N452Y	possibly damaging	Het
Scgb2b3	T	A	7: 31,360,214	H45L	possibly damaging	Het
Sim1	A	G	10: 50,895,927	T11A	probably damaging	Het
Slc5a12	T	A	2: 110,616,714	M189K	possibly damaging	Het
Slco2b1	C	T	7: 99,695,063	G10S	probably null	Het
Stxbp3	A	G	3: 108,800,755	L410P	probably damaging	Het
Sugct	T	C	13: 17,302,009	N297D	probably benign	Het
Syne1	A	G	10: 5,233,409	I4132T	probably benign	Het
Teddm1b	A	T	1: 153,875,166	L240F	probably damaging	Het
Tlr5	C	A	1: 182,975,523	D797E	possibly damaging	Het
Tmprss13	G	T	9: 45,338,345	G327C	probably damaging	Het
Tnrc18	G	T	5: 142,787,817	A419D		Het
Ttc28	T	C	5: 111,280,007	Y1790H	probably damaging	Het
Vmn1r125	T	G	7: 21,272,402	M75R	probably damaging	Het
Vwa3a	T	A	7: 120,773,030	D276E	possibly damaging	Het
Wdfy3	C	T	5: 101,915,437	V1322M	probably damaging	Het
Wdr11	T	C	7: 129,628,106	S872P	possibly damaging	Het
Zc3h13	T	C	14: 75,321,721	S357P	unknown	Het

Other mutations in Crb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00593:Crb1	APN	1	139323245	missense	probably benign	0.16
IGL01591:Crb1	APN	1	139237339	missense	probably damaging	1.00
IGL01644:Crb1	APN	1	139237630	nonsense	probably null
IGL01769:Crb1	APN	1	139337068	missense	probably damaging	1.00
IGL02172:Crb1	APN	1	139237227	missense	probably damaging	1.00
IGL02294:Crb1	APN	1	139234782	missense	possibly damaging	0.89
IGL02382:Crb1	APN	1	139237614	missense	probably damaging	0.99
IGL02411:Crb1	APN	1	139248475	missense	probably damaging	1.00
IGL03070:Crb1	APN	1	139241258	missense	possibly damaging	0.79
IGL02984:Crb1	UTSW	1	139237086	frame shift	probably null
IGL02988:Crb1	UTSW	1	139237086	frame shift	probably null
IGL02991:Crb1	UTSW	1	139237084	frame shift	probably null
IGL02991:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03014:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03050:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03054:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03055:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03097:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03098:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03134:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03138:Crb1	UTSW	1	139237086	frame shift	probably null
IGL03147:Crb1	UTSW	1	139237086	frame shift	probably null
P0017:Crb1	UTSW	1	139248940	missense	possibly damaging	0.64
R0276:Crb1	UTSW	1	139323335	missense	possibly damaging	0.85
R0325:Crb1	UTSW	1	139241166	missense	probably damaging	1.00
R0401:Crb1	UTSW	1	139198791	splice site	probably benign
R0479:Crb1	UTSW	1	139198614	missense	probably damaging	0.98
R0734:Crb1	UTSW	1	139337084	missense	probably benign	0.25
R1573:Crb1	UTSW	1	139337606	missense	probably damaging	1.00
R1728:Crb1	UTSW	1	139234779	missense	probably benign
R1728:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1728:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1728:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1728:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1729:Crb1	UTSW	1	139234779	missense	probably benign
R1729:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1729:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1729:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1729:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1730:Crb1	UTSW	1	139234779	missense	probably benign
R1730:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1730:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1730:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1730:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1739:Crb1	UTSW	1	139234779	missense	probably benign
R1739:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1739:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1739:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1739:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1762:Crb1	UTSW	1	139234779	missense	probably benign
R1762:Crb1	UTSW	1	139237531	missense	probably damaging	1.00
R1762:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1762:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1762:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1762:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1783:Crb1	UTSW	1	139234779	missense	probably benign
R1783:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1783:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1783:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1783:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1784:Crb1	UTSW	1	139234779	missense	probably benign
R1784:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1784:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1784:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1784:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1785:Crb1	UTSW	1	139234779	missense	probably benign
R1785:Crb1	UTSW	1	139237622	missense	probably benign	0.00
R1785:Crb1	UTSW	1	139241138	missense	probably damaging	1.00
R1785:Crb1	UTSW	1	139242995	missense	probably damaging	1.00
R1785:Crb1	UTSW	1	139243417	missense	probably benign	0.00
R1848:Crb1	UTSW	1	139237012	missense	probably damaging	0.97
R1894:Crb1	UTSW	1	139243193	missense	probably benign	0.02
R2057:Crb1	UTSW	1	139314750	missense	probably damaging	1.00
R2136:Crb1	UTSW	1	139337425	missense	probably benign	0.03
R2140:Crb1	UTSW	1	139237012	missense	probably benign	0.01
R2363:Crb1	UTSW	1	139337278	missense	possibly damaging	0.89
R3605:Crb1	UTSW	1	139237339	missense	probably damaging	1.00
R3817:Crb1	UTSW	1	139248097	missense	probably benign
R3942:Crb1	UTSW	1	139337473	missense	possibly damaging	0.49
R4272:Crb1	UTSW	1	139323311	missense	probably benign	0.04
R4301:Crb1	UTSW	1	139248830	missense	probably benign	0.01
R4403:Crb1	UTSW	1	139248379	missense	probably benign	0.00
R4700:Crb1	UTSW	1	139198771	missense	probably damaging	0.96
R4771:Crb1	UTSW	1	139328204	missense	probably damaging	1.00
R4845:Crb1	UTSW	1	139243034	missense	probably benign	0.06
R4867:Crb1	UTSW	1	139243014	missense	probably damaging	1.00
R5159:Crb1	UTSW	1	139243018	missense	probably damaging	0.99
R5270:Crb1	UTSW	1	139236864	missense	probably damaging	0.97
R5347:Crb1	UTSW	1	139337371	missense	probably damaging	1.00
R5513:Crb1	UTSW	1	139236821	critical splice donor site	probably null
R5641:Crb1	UTSW	1	139248889	missense	probably damaging	0.99
R5754:Crb1	UTSW	1	139231599	missense	probably damaging	1.00
R5968:Crb1	UTSW	1	139243001	missense	probably damaging	1.00
R6122:Crb1	UTSW	1	139248948	nonsense	probably null
R6369:Crb1	UTSW	1	139237462	missense	probably damaging	1.00
R6809:Crb1	UTSW	1	139243126	missense	probably benign	0.00
R7020:Crb1	UTSW	1	139231603	missense	possibly damaging	0.85
R7072:Crb1	UTSW	1	139237275	missense	probably damaging	1.00
R7073:Crb1	UTSW	1	139248311	missense	probably damaging	0.99
R7493:Crb1	UTSW	1	139237030	missense	probably damaging	1.00
R7539:Crb1	UTSW	1	139248229	missense	probably damaging	1.00
R7554:Crb1	UTSW	1	139337281	missense	probably damaging	1.00
R7593:Crb1	UTSW	1	139237240	missense	probably damaging	1.00
R7740:Crb1	UTSW	1	139237690	missense	probably benign	0.01
R7912:Crb1	UTSW	1	139243171	missense	probably damaging	1.00
R8036:Crb1	UTSW	1	139237384	missense	probably benign	0.07
R8042:Crb1	UTSW	1	139314654	missense	probably damaging	0.99
R8329:Crb1	UTSW	1	139237267	missense	probably damaging	1.00
R8332:Crb1	UTSW	1	139237414	missense	probably damaging	0.96
X0066:Crb1	UTSW	1	139248245	missense	probably benign	0.10
Z1176:Crb1	UTSW	1	139237086	frame shift	probably null
Z1177:Crb1	UTSW	1	139237086	frame shift	probably null
Z1177:Crb1	UTSW	1	139248901	missense	possibly damaging	0.80
Z1177:Crb1	UTSW	1	139337028	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCTCTGTCAGGTAAGCCAC -3'
(R):5'- TTGGACATTGCAGAGTATGTAGCG -3'

Sequencing Primer
(F):5'- GAAGATGACGTCTCCTCTTCGAATTG -3'
(R):5'- TAGCGGGAAGATTTGGCC -3'

Posted On

2019-05-15