Mutagenetix > Incidental Mutations

Incidental Mutation 'R7135:Tlr5'

552972

Institutional Source

Beutler Lab

Gene Symbol

Tlr5

Ensembl Gene

ENSMUSG00000079164

Gene Name

toll-like receptor 5

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.259) question?

Stock #

R7135 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

182954788-182976044 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 182975523 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 797 (D797E)

Ref Sequence

ENSEMBL: ENSMUSP00000106625 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110997] [ENSMUST00000191820] [ENSMUST00000193687]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110997
AA Change: D797E

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000106625
Gene: ENSMUSG00000079164
AA Change: D797E

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	3.11e-2	SMART
LRR	159	183	5.56e0	SMART
LRR	184	207	1.97e2	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	7.05e-1	SMART
LRR	350	373	2.92e1	SMART
LRR	374	397	2.54e1	SMART
LRR	398	418	1.29e2	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	1.06e-4	SMART
LRR	540	563	6.13e-1	SMART
LRR	564	585	2.21e2	SMART
LRRCT	594	645	7.01e-6	SMART
low complexity region	657	676	N/A	INTRINSIC
TIR	707	852	3.89e-25	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000191820
AA Change: D783E

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000141458
Gene: ENSMUSG00000079164
AA Change: D783E

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
low complexity region	69	78	N/A	INTRINSIC
LRR_TYP	95	118	1.3e-4	SMART
LRR	145	169	2.3e-2	SMART
LRR	170	193	8.2e-1	SMART
low complexity region	248	261	N/A	INTRINSIC
LRR	312	335	2.9e-3	SMART
LRR	336	359	1.2e-1	SMART
LRR	360	383	1.1e-1	SMART
LRR	384	404	5.4e-1	SMART
low complexity region	427	442	N/A	INTRINSIC
LRR_TYP	502	525	4.5e-7	SMART
LRR	526	549	2.5e-3	SMART
LRR	550	571	9.4e-1	SMART
LRRCT	580	631	3.4e-8	SMART
transmembrane domain	642	664	N/A	INTRINSIC
TIR	693	838	2.5e-27	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193687
AA Change: D797E

PolyPhen 2 Score 0.865 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000141318
Gene: ENSMUSG00000079164
AA Change: D797E

Domain	Start	End	E-Value	Type
low complexity region	83	92	N/A	INTRINSIC
LRR_TYP	109	132	1.3e-4	SMART
LRR	159	183	2.3e-2	SMART
LRR	184	207	8.2e-1	SMART
low complexity region	262	275	N/A	INTRINSIC
LRR	326	349	2.9e-3	SMART
LRR	350	373	1.2e-1	SMART
LRR	374	397	1.1e-1	SMART
LRR	398	418	5.4e-1	SMART
low complexity region	441	456	N/A	INTRINSIC
LRR_TYP	516	539	4.5e-7	SMART
LRR	540	563	2.5e-3	SMART
LRR	564	585	9.4e-1	SMART
LRRCT	594	645	3.4e-8	SMART
transmembrane domain	656	678	N/A	INTRINSIC
TIR	707	852	2.5e-27	SMART

Meta Mutation Damage Score

0.1125

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the toll-like receptor (TLR) family, which plays a fundamental role in pathogen recognition and activation of innate immune responses. These receptors recognize distinct pathogen-associated molecular patterns that are expressed on infectious agents. The protein encoded by this gene recognizes bacterial flagellin, the principal component of bacterial flagella and a virulence factor. The activation of this receptor mobilizes the nuclear factor NF-kappaB, which in turn activates a host of inflammatory-related target genes. Mutations in this gene have been associated with both resistance and susceptibility to systemic lupus erythematosus, and susceptibility to Legionnaire disease.[provided by RefSeq, Dec 2009]
PHENOTYPE: Mice homozygous for disruption of this gene have a generally normal phenotype. However they fail to respond immunologically to purified flagellin and are resistant to infection with Salmonella typhimurium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016G14Rik	T	C	13: 24,741,506	S78P	probably benign	Het
Aars2	T	A	17: 45,508,961	Y221*	probably null	Het
AC166344.1	T	A	14: 43,300,788	F97I		Het
Ankmy2	T	C	12: 36,196,312	S412P	probably benign	Het
Ap1s3	T	C	1: 79,609,202	T144A	probably benign	Het
Asb3	T	A	11: 30,998,501	L59*	probably null	Het
Asxl3	G	T	18: 22,517,701	G916*	probably null	Het
Asxl3	G	C	18: 22,517,702	G916A	probably damaging	Het
Birc2	A	C	9: 7,818,761	F610V	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccdc162	A	G	10: 41,673,859	S343P	probably benign	Het
Ccnk	T	A	12: 108,186,475	L17Q	probably damaging	Het
Cd59b	G	A	2: 104,084,447	W63*	probably null	Het
Chrm3	C	T	13: 9,877,801	V400I	probably benign	Het
Crb1	C	A	1: 139,243,367	V762F	probably damaging	Het
Cspp1	C	T	1: 10,088,936	T529I	possibly damaging	Het
Cttnbp2	A	G	6: 18,448,447	I71T	possibly damaging	Het
Cyb561	C	A	11: 105,935,567	G90V	probably damaging	Het
Cyld	T	A	8: 88,744,892	D804E	possibly damaging	Het
Ddx31	G	A	2: 28,848,306	V160I	probably benign	Het
Dgkg	T	C	16: 22,500,382	D643G	probably damaging	Het
Dnah12	T	G	14: 26,801,413	I1953S	probably damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnah7b	T	C	1: 46,139,710	W848R	probably damaging	Het
Dnah7c	C	T	1: 46,533,208	T947M	probably damaging	Het
Dnmt3c	C	A	2: 153,714,952		probably null	Het
Dsp	A	T	13: 38,179,073	Y443F	probably damaging	Het
Espl1	T	A	15: 102,319,524	C1603*	probably null	Het
Faiml	G	T	9: 99,234,443	R65S	probably benign	Het
Gfpt2	T	C	11: 49,804,955	I4T	probably damaging	Het
Gm10376	T	A	14: 43,010,493	M179L	probably benign	Het
Gm13084	A	T	4: 143,810,663	L366Q	probably damaging	Het
Gm4302	T	A	10: 100,341,727	M291K	unknown	Het
Gm8906	C	T	5: 11,505,231	P83S	probably damaging	Het
Gnb1l	T	A	16: 18,545,168	D154E	probably benign	Het
Igkv10-94	T	C	6: 68,704,743	R38G	possibly damaging	Het
Inmt	A	T	6: 55,171,028	Y205*	probably null	Het
Krba1	A	G	6: 48,416,299	Q1049R	probably benign	Het
Lpxn	T	A	19: 12,833,319	C376S	probably damaging	Het
Lrrc52	T	A	1: 167,466,450	I89F	probably damaging	Het
Map9	A	T	3: 82,363,458	T110S	probably benign	Het
Mccc1	T	C	3: 35,995,818	Y75C	probably damaging	Het
Mff	T	A	1: 82,747,091	L203*	probably null	Het
Micall1	C	A	15: 79,109,424	D47E	unknown	Het
Mink1	T	C	11: 70,603,503	F243S	probably damaging	Het
Mlycd	C	T	8: 119,402,477	R228W	probably damaging	Het
Msr1	A	T	8: 39,589,424	V370E	possibly damaging	Het
Naip6	T	C	13: 100,300,419	E532G	probably damaging	Het
Nepn	G	A	10: 52,391,719	C27Y	probably damaging	Het
Ninl	T	C	2: 150,955,604	H592R	probably benign	Het
Nr4a2	A	G	2: 57,112,249	M64T	possibly damaging	Het
Olfr1279	T	A	2: 111,307,020	F272I	probably benign	Het
Olfr484	T	C	7: 108,124,574	K230E	probably damaging	Het
Oprm1	A	T	10: 6,830,203	I171F	possibly damaging	Het
Pcbp1	A	T	6: 86,525,506	M137K	possibly damaging	Het
Pcf11	A	T	7: 92,657,316	S1215T	probably benign	Het
Pdlim5	A	T	3: 142,311,922		probably null	Het
Pecam1	T	C	11: 106,689,031	I402V	probably damaging	Het
Pex12	T	C	11: 83,297,642	T176A	probably benign	Het
Phf3	T	C	1: 30,831,109	K286R	possibly damaging	Het
Pik3ap1	T	A	19: 41,332,321	D153V	probably damaging	Het
Pkhd1l1	T	A	15: 44,584,978		probably null	Het
Plekhn1	A	G	4: 156,223,335	V378A	probably benign	Het
Ptprm	A	T	17: 66,944,288	D531E	possibly damaging	Het
Pum2	A	T	12: 8,728,952	Q508L	possibly damaging	Het
Rad54l	A	G	4: 116,105,830	S324P	probably damaging	Het
Recql5	C	T	11: 115,930,672		probably null	Het
Reln	A	T	5: 21,976,596	V1763D	possibly damaging	Het
Rp1	T	C	1: 4,348,168	N907S	possibly damaging	Het
Scaf11	T	A	15: 96,420,328	N452Y	possibly damaging	Het
Scgb2b3	T	A	7: 31,360,214	H45L	possibly damaging	Het
Sim1	A	G	10: 50,895,927	T11A	probably damaging	Het
Slc5a12	T	A	2: 110,616,714	M189K	possibly damaging	Het
Slco2b1	C	T	7: 99,695,063	G10S	probably null	Het
Stxbp3	A	G	3: 108,800,755	L410P	probably damaging	Het
Sugct	T	C	13: 17,302,009	N297D	probably benign	Het
Syne1	A	G	10: 5,233,409	I4132T	probably benign	Het
Teddm1b	A	T	1: 153,875,166	L240F	probably damaging	Het
Tmprss13	G	T	9: 45,338,345	G327C	probably damaging	Het
Tnrc18	G	T	5: 142,787,817	A419D		Het
Ttc28	T	C	5: 111,280,007	Y1790H	probably damaging	Het
Vmn1r125	T	G	7: 21,272,402	M75R	probably damaging	Het
Vwa3a	T	A	7: 120,773,030	D276E	possibly damaging	Het
Wdfy3	C	T	5: 101,915,437	V1322M	probably damaging	Het
Wdr11	T	C	7: 129,628,106	S872P	possibly damaging	Het
Zc3h13	T	C	14: 75,321,721	S357P	unknown	Het

Other mutations in Tlr5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00479:Tlr5	APN	1	182973829	missense	probably benign
IGL00940:Tlr5	APN	1	182974196	missense	possibly damaging	0.84
IGL01302:Tlr5	APN	1	182974748	missense	probably benign	0.00
IGL01480:Tlr5	APN	1	182973499	missense	probably benign	0.09
IGL01717:Tlr5	APN	1	182975398	missense	probably damaging	1.00
IGL01896:Tlr5	APN	1	182974879	missense	possibly damaging	0.64
IGL02083:Tlr5	APN	1	182973884	missense	possibly damaging	0.91
IGL02135:Tlr5	APN	1	182973254	missense	possibly damaging	0.82
R0464:Tlr5	UTSW	1	182973710	missense	probably benign	0.01
R0552:Tlr5	UTSW	1	182975696	splice site	probably null
R0556:Tlr5	UTSW	1	182974151	missense	probably damaging	1.00
R0639:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R0670:Tlr5	UTSW	1	182973889	missense	probably damaging	1.00
R1014:Tlr5	UTSW	1	182975677	missense	probably benign	0.00
R1125:Tlr5	UTSW	1	182973892	missense	probably benign	0.00
R1563:Tlr5	UTSW	1	182975010	missense	probably benign	0.09
R1775:Tlr5	UTSW	1	182973722	missense	probably damaging	0.99
R1793:Tlr5	UTSW	1	182972447	missense	probably benign	0.00
R1991:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R1992:Tlr5	UTSW	1	182974347	missense	probably damaging	1.00
R2114:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2116:Tlr5	UTSW	1	182975629	missense	probably damaging	1.00
R2225:Tlr5	UTSW	1	182972376	start gained	probably benign
R2265:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2266:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2268:Tlr5	UTSW	1	182975035	missense	possibly damaging	0.63
R2882:Tlr5	UTSW	1	182973893	missense	probably damaging	1.00
R3695:Tlr5	UTSW	1	182975347	missense	probably damaging	1.00
R3747:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R3749:Tlr5	UTSW	1	182974439	missense	probably benign	0.01
R4084:Tlr5	UTSW	1	182974848	missense	possibly damaging	0.60
R4794:Tlr5	UTSW	1	182973896	missense	probably benign	0.00
R4895:Tlr5	UTSW	1	182974199	missense	probably damaging	1.00
R4964:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R4966:Tlr5	UTSW	1	182973473	missense	probably benign	0.07
R5496:Tlr5	UTSW	1	182973632	missense	probably damaging	1.00
R6056:Tlr5	UTSW	1	182974038	missense	possibly damaging	0.76
R6715:Tlr5	UTSW	1	182972659	intron	probably benign
R6825:Tlr5	UTSW	1	182973044	intron	probably benign
R6961:Tlr5	UTSW	1	182973511	nonsense	probably null
R7232:Tlr5	UTSW	1	182973499	missense	probably benign	0.09
R7255:Tlr5	UTSW	1	182974316	missense	probably damaging	1.00
R7257:Tlr5	UTSW	1	182974233	nonsense	probably null
Z1177:Tlr5	UTSW	1	182973817	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- ACAGTTCCCGAAACAGGCTC -3'
(R):5'- TCGCAACTGGATGGAACTG -3'

Sequencing Primer
(F):5'- AAACAGGCTCAGGCTATGCTTTG -3'
(R):5'- AACTGGATGGAACTGCTTCTTTTC -3'

Posted On

2019-05-15