Mutagenetix > Incidental Mutations

Incidental Mutation 'R7135:Reln'

552986

Institutional Source

Beutler Lab

Gene Symbol

Reln

Ensembl Gene

ENSMUSG00000042453

Gene Name

reelin

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.950) question?

Stock #

R7135 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21884454-22344702 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 21976596 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1763 (V1763D)

Ref Sequence

ENSEMBL: ENSMUSP00000124052 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062372
AA Change: V1763D

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: V1763D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	40	172	6.1e-24	PFAM
internal_repeat_3	195	360	5.04e-6	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3450	3457	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161356
AA Change: V1763D

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: V1763D

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:Reeler	54	171	2.9e-10	PFAM
internal_repeat_3	195	360	5.06e-6	PROSPERO
internal_repeat_2	207	413	3.41e-11	PROSPERO
EGF	674	702	1.2e1	SMART
EGF_like	1033	1061	6.95e1	SMART
EGF	1412	1442	6.02e0	SMART
internal_repeat_2	1452	1660	3.41e-11	PROSPERO
EGF_like	1768	1796	2.92e1	SMART
low complexity region	1939	1948	N/A	INTRINSIC
low complexity region	2062	2071	N/A	INTRINSIC
EGF	2132	2161	1.43e-1	SMART
EGF_like	2481	2509	3.43e1	SMART
EGF	2856	2884	2.2e1	SMART
EGF	3231	3260	3.46e0	SMART
low complexity region	3452	3459	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016G14Rik	T	C	13: 24,741,506	S78P	probably benign	Het
Aars2	T	A	17: 45,508,961	Y221*	probably null	Het
AC166344.1	T	A	14: 43,300,788	F97I		Het
Ankmy2	T	C	12: 36,196,312	S412P	probably benign	Het
Ap1s3	T	C	1: 79,609,202	T144A	probably benign	Het
Asb3	T	A	11: 30,998,501	L59*	probably null	Het
Asxl3	G	T	18: 22,517,701	G916*	probably null	Het
Asxl3	G	C	18: 22,517,702	G916A	probably damaging	Het
Birc2	A	C	9: 7,818,761	F610V	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccdc162	A	G	10: 41,673,859	S343P	probably benign	Het
Ccnk	T	A	12: 108,186,475	L17Q	probably damaging	Het
Cd59b	G	A	2: 104,084,447	W63*	probably null	Het
Chrm3	C	T	13: 9,877,801	V400I	probably benign	Het
Crb1	C	A	1: 139,243,367	V762F	probably damaging	Het
Cspp1	C	T	1: 10,088,936	T529I	possibly damaging	Het
Cttnbp2	A	G	6: 18,448,447	I71T	possibly damaging	Het
Cyb561	C	A	11: 105,935,567	G90V	probably damaging	Het
Cyld	T	A	8: 88,744,892	D804E	possibly damaging	Het
Ddx31	G	A	2: 28,848,306	V160I	probably benign	Het
Dgkg	T	C	16: 22,500,382	D643G	probably damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnah12	T	G	14: 26,801,413	I1953S	probably damaging	Het
Dnah7b	T	C	1: 46,139,710	W848R	probably damaging	Het
Dnah7c	C	T	1: 46,533,208	T947M	probably damaging	Het
Dnmt3c	C	A	2: 153,714,952		probably null	Het
Dsp	A	T	13: 38,179,073	Y443F	probably damaging	Het
Espl1	T	A	15: 102,319,524	C1603*	probably null	Het
Faiml	G	T	9: 99,234,443	R65S	probably benign	Het
Gfpt2	T	C	11: 49,804,955	I4T	probably damaging	Het
Gm10376	T	A	14: 43,010,493	M179L	probably benign	Het
Gm13084	A	T	4: 143,810,663	L366Q	probably damaging	Het
Gm4302	T	A	10: 100,341,727	M291K	unknown	Het
Gm8906	C	T	5: 11,505,231	P83S	probably damaging	Het
Gnb1l	T	A	16: 18,545,168	D154E	probably benign	Het
Igkv10-94	T	C	6: 68,704,743	R38G	possibly damaging	Het
Inmt	A	T	6: 55,171,028	Y205*	probably null	Het
Krba1	A	G	6: 48,416,299	Q1049R	probably benign	Het
Lpxn	T	A	19: 12,833,319	C376S	probably damaging	Het
Lrrc52	T	A	1: 167,466,450	I89F	probably damaging	Het
Map9	A	T	3: 82,363,458	T110S	probably benign	Het
Mccc1	T	C	3: 35,995,818	Y75C	probably damaging	Het
Mff	T	A	1: 82,747,091	L203*	probably null	Het
Micall1	C	A	15: 79,109,424	D47E	unknown	Het
Mink1	T	C	11: 70,603,503	F243S	probably damaging	Het
Mlycd	C	T	8: 119,402,477	R228W	probably damaging	Het
Msr1	A	T	8: 39,589,424	V370E	possibly damaging	Het
Naip6	T	C	13: 100,300,419	E532G	probably damaging	Het
Nepn	G	A	10: 52,391,719	C27Y	probably damaging	Het
Ninl	T	C	2: 150,955,604	H592R	probably benign	Het
Nr4a2	A	G	2: 57,112,249	M64T	possibly damaging	Het
Olfr1279	T	A	2: 111,307,020	F272I	probably benign	Het
Olfr484	T	C	7: 108,124,574	K230E	probably damaging	Het
Oprm1	A	T	10: 6,830,203	I171F	possibly damaging	Het
Pcbp1	A	T	6: 86,525,506	M137K	possibly damaging	Het
Pcf11	A	T	7: 92,657,316	S1215T	probably benign	Het
Pdlim5	A	T	3: 142,311,922		probably null	Het
Pecam1	T	C	11: 106,689,031	I402V	probably damaging	Het
Pex12	T	C	11: 83,297,642	T176A	probably benign	Het
Phf3	T	C	1: 30,831,109	K286R	possibly damaging	Het
Pik3ap1	T	A	19: 41,332,321	D153V	probably damaging	Het
Pkhd1l1	T	A	15: 44,584,978		probably null	Het
Plekhn1	A	G	4: 156,223,335	V378A	probably benign	Het
Ptprm	A	T	17: 66,944,288	D531E	possibly damaging	Het
Pum2	A	T	12: 8,728,952	Q508L	possibly damaging	Het
Rad54l	A	G	4: 116,105,830	S324P	probably damaging	Het
Recql5	C	T	11: 115,930,672		probably null	Het
Rp1	T	C	1: 4,348,168	N907S	possibly damaging	Het
Scaf11	T	A	15: 96,420,328	N452Y	possibly damaging	Het
Scgb2b3	T	A	7: 31,360,214	H45L	possibly damaging	Het
Sim1	A	G	10: 50,895,927	T11A	probably damaging	Het
Slc5a12	T	A	2: 110,616,714	M189K	possibly damaging	Het
Slco2b1	C	T	7: 99,695,063	G10S	probably null	Het
Stxbp3	A	G	3: 108,800,755	L410P	probably damaging	Het
Sugct	T	C	13: 17,302,009	N297D	probably benign	Het
Syne1	A	G	10: 5,233,409	I4132T	probably benign	Het
Teddm1b	A	T	1: 153,875,166	L240F	probably damaging	Het
Tlr5	C	A	1: 182,975,523	D797E	possibly damaging	Het
Tmprss13	G	T	9: 45,338,345	G327C	probably damaging	Het
Tnrc18	G	T	5: 142,787,817	A419D		Het
Ttc28	T	C	5: 111,280,007	Y1790H	probably damaging	Het
Vmn1r125	T	G	7: 21,272,402	M75R	probably damaging	Het
Vwa3a	T	A	7: 120,773,030	D276E	possibly damaging	Het
Wdfy3	C	T	5: 101,915,437	V1322M	probably damaging	Het
Wdr11	T	C	7: 129,628,106	S872P	possibly damaging	Het
Zc3h13	T	C	14: 75,321,721	S357P	unknown	Het

Other mutations in Reln

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00091:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL00432:Reln	APN	5	22010127	missense	probably damaging	1.00
IGL00433:Reln	APN	5	22045009	missense	probably damaging	1.00
IGL00576:Reln	APN	5	22154950	missense	probably benign	0.01
IGL00755:Reln	APN	5	22060380	missense	probably damaging	0.98
IGL00777:Reln	APN	5	22018850	critical splice donor site	probably null
IGL00900:Reln	APN	5	21980117	missense	probably damaging	0.98
IGL01067:Reln	APN	5	21979666	missense	probably damaging	1.00
IGL01104:Reln	APN	5	21986967	missense	probably damaging	0.99
IGL01141:Reln	APN	5	21969033	missense	probably damaging	1.00
IGL01141:Reln	APN	5	21919069	missense	probably damaging	1.00
IGL01333:Reln	APN	5	22171251	missense	probably damaging	0.99
IGL01341:Reln	APN	5	21969079	missense	probably damaging	1.00
IGL01354:Reln	APN	5	21919175	nonsense	probably null
IGL01361:Reln	APN	5	21919021	missense	probably benign	0.06
IGL01446:Reln	APN	5	21969317	missense	probably damaging	0.99
IGL01448:Reln	APN	5	22040405	missense	probably benign	0.40
IGL01612:Reln	APN	5	21896930	missense	probably damaging	0.99
IGL01695:Reln	APN	5	21920438	missense	probably damaging	1.00
IGL01718:Reln	APN	5	21947514	missense	possibly damaging	0.60
IGL01749:Reln	APN	5	22344246	nonsense	probably null
IGL01875:Reln	APN	5	21904717	missense	probably benign
IGL02013:Reln	APN	5	21950879	missense	probably damaging	1.00
IGL02031:Reln	APN	5	21979016	missense	probably damaging	0.99
IGL02186:Reln	APN	5	21909958	missense	probably damaging	1.00
IGL02228:Reln	APN	5	21904731	missense	probably damaging	0.99
IGL02248:Reln	APN	5	21910992	missense	probably damaging	1.00
IGL02336:Reln	APN	5	21929134	missense	probably damaging	1.00
IGL02352:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02359:Reln	APN	5	22039565	missense	possibly damaging	0.57
IGL02376:Reln	APN	5	22080791	nonsense	probably null
IGL02408:Reln	APN	5	21901619	missense	probably benign	0.44
IGL02415:Reln	APN	5	21971951	missense	possibly damaging	0.91
IGL02512:Reln	APN	5	22040427	missense	probably benign	0.00
IGL02540:Reln	APN	5	22034752	missense	probably damaging	0.96
IGL02624:Reln	APN	5	22103357	missense	probably benign	0.09
IGL02720:Reln	APN	5	21997941	missense	probably damaging	0.99
IGL02894:Reln	APN	5	21885548	missense	possibly damaging	0.72
IGL02999:Reln	APN	5	21995365	missense	probably damaging	1.00
IGL03125:Reln	APN	5	21910844	missense	probably damaging	1.00
IGL03298:Reln	APN	5	21910836	missense	probably damaging	0.99
Fishing	UTSW	5	21896841	missense	probably damaging	1.00
P0020:Reln	UTSW	5	22106060	missense	possibly damaging	0.91
PIT4151001:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R0018:Reln	UTSW	5	21925371	missense	probably benign	0.01
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0105:Reln	UTSW	5	22048815	missense	probably damaging	0.99
R0127:Reln	UTSW	5	22004136	missense	probably damaging	1.00
R0135:Reln	UTSW	5	22128649	missense	probably damaging	0.99
R0144:Reln	UTSW	5	21948449	missense	probably damaging	0.97
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0240:Reln	UTSW	5	22106045	missense	probably benign	0.36
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0242:Reln	UTSW	5	21942597	critical splice donor site	probably null
R0266:Reln	UTSW	5	21988776	missense	probably damaging	1.00
R0269:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0280:Reln	UTSW	5	22227513	splice site	probably benign
R0333:Reln	UTSW	5	21929242	missense	probably damaging	0.97
R0357:Reln	UTSW	5	21950822	missense	probably damaging	1.00
R0359:Reln	UTSW	5	22048800	missense	probably damaging	0.98
R0506:Reln	UTSW	5	21920496	missense	probably damaging	0.97
R0534:Reln	UTSW	5	21947408	missense	probably damaging	0.99
R0535:Reln	UTSW	5	22051276	splice site	probably benign
R0541:Reln	UTSW	5	21980109	missense	possibly damaging	0.88
R0615:Reln	UTSW	5	22010150	missense	probably benign	0.36
R0617:Reln	UTSW	5	21920537	missense	probably damaging	1.00
R0634:Reln	UTSW	5	22018869	missense	probably damaging	1.00
R0653:Reln	UTSW	5	21913230	missense	probably benign	0.44
R0704:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0706:Reln	UTSW	5	21896811	missense	probably damaging	0.99
R0959:Reln	UTSW	5	22227628	missense	probably damaging	0.96
R1066:Reln	UTSW	5	22034664	missense	probably damaging	1.00
R1110:Reln	UTSW	5	22034775	missense	probably benign
R1163:Reln	UTSW	5	21899029	missense	probably benign	0.03
R1222:Reln	UTSW	5	21986955	missense	probably null	0.97
R1226:Reln	UTSW	5	21910866	missense	probably damaging	1.00
R1440:Reln	UTSW	5	22128602	splice site	probably benign
R1532:Reln	UTSW	5	22034744	missense	probably damaging	0.99
R1552:Reln	UTSW	5	21960378	missense	probably benign	0.01
R1565:Reln	UTSW	5	21925213	missense	probably benign	0.05
R1618:Reln	UTSW	5	22060368	missense	probably benign	0.01
R1636:Reln	UTSW	5	21998683	missense	probably damaging	0.99
R1664:Reln	UTSW	5	21929086	missense	probably damaging	1.00
R1716:Reln	UTSW	5	21955095	missense	probably damaging	0.98
R1759:Reln	UTSW	5	22010289	missense	probably damaging	0.99
R1835:Reln	UTSW	5	21979002	missense	probably damaging	1.00
R1907:Reln	UTSW	5	22044962	critical splice donor site	probably null
R1991:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2046:Reln	UTSW	5	21942627	missense	probably benign	0.01
R2072:Reln	UTSW	5	21919177	missense	probably damaging	1.00
R2103:Reln	UTSW	5	21969360	missense	possibly damaging	0.56
R2119:Reln	UTSW	5	22019000	missense	probably damaging	1.00
R2120:Reln	UTSW	5	21969085	missense	probably damaging	1.00
R2216:Reln	UTSW	5	22048005	missense	probably benign	0.30
R2219:Reln	UTSW	5	21972047	missense	possibly damaging	0.88
R2228:Reln	UTSW	5	21987078	missense	possibly damaging	0.69
R2306:Reln	UTSW	5	21896786	missense	probably damaging	1.00
R2316:Reln	UTSW	5	22154956	missense	probably benign	0.00
R2321:Reln	UTSW	5	21915020	missense	probably damaging	0.99
R2512:Reln	UTSW	5	21979690	missense	possibly damaging	0.89
R2519:Reln	UTSW	5	22344369	missense	unknown
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2870:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2871:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R2872:Reln	UTSW	5	22049791	missense	possibly damaging	0.95
R3195:Reln	UTSW	5	22040420	missense	possibly damaging	0.72
R3545:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3546:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3547:Reln	UTSW	5	22227600	missense	possibly damaging	0.64
R3706:Reln	UTSW	5	21995589	splice site	probably benign
R3713:Reln	UTSW	5	21904734	missense	probably damaging	0.99
R3770:Reln	UTSW	5	21948566	missense	probably damaging	1.00
R3836:Reln	UTSW	5	21911014	missense	probably damaging	1.00
R3887:Reln	UTSW	5	21910849	missense	possibly damaging	0.92
R3972:Reln	UTSW	5	21979001	missense	probably damaging	0.99
R3975:Reln	UTSW	5	21995366	missense	possibly damaging	0.57
R4022:Reln	UTSW	5	22227630	missense	probably benign	0.45
R4044:Reln	UTSW	5	22128632	missense	possibly damaging	0.82
R4107:Reln	UTSW	5	22034584	missense	probably damaging	1.00
R4297:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4298:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4299:Reln	UTSW	5	21920487	missense	probably damaging	0.99
R4518:Reln	UTSW	5	21901743	missense	probably benign	0.44
R4615:Reln	UTSW	5	21972872	missense	possibly damaging	0.95
R4713:Reln	UTSW	5	22152463	missense	probably benign	0.17
R4720:Reln	UTSW	5	22286896	missense	possibly damaging	0.71
R4721:Reln	UTSW	5	21919222	missense	probably damaging	0.99
R4771:Reln	UTSW	5	22049700	missense	probably damaging	1.00
R4794:Reln	UTSW	5	22344185	missense	probably damaging	0.98
R4840:Reln	UTSW	5	22018846	splice site	probably null
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4860:Reln	UTSW	5	21901751	missense	probably benign	0.06
R4896:Reln	UTSW	5	21955238	missense	probably damaging	1.00
R4908:Reln	UTSW	5	21979720	missense	probably benign	0.02
R4912:Reln	UTSW	5	21925193	missense	probably benign	0.29
R4922:Reln	UTSW	5	21995587	critical splice acceptor site	probably null
R4975:Reln	UTSW	5	21960426	missense	probably damaging	1.00
R4976:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5020:Reln	UTSW	5	22034638	missense	probably damaging	1.00
R5037:Reln	UTSW	5	21948512	missense	probably damaging	1.00
R5082:Reln	UTSW	5	21896077	missense	probably benign	0.00
R5119:Reln	UTSW	5	21971870	missense	probably benign	0.05
R5125:Reln	UTSW	5	21913241	missense	possibly damaging	0.78
R5137:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R5152:Reln	UTSW	5	21948629	missense	probably damaging	1.00
R5154:Reln	UTSW	5	21988765	missense	probably damaging	0.99
R5259:Reln	UTSW	5	22103397	missense	possibly damaging	0.83
R5283:Reln	UTSW	5	22011163	missense	probably damaging	1.00
R5386:Reln	UTSW	5	22039529	missense	probably benign
R5400:Reln	UTSW	5	21979714	missense	probably damaging	1.00
R5478:Reln	UTSW	5	22004203	missense	probably benign	0.00
R5514:Reln	UTSW	5	21971885	missense	possibly damaging	0.93
R5529:Reln	UTSW	5	21932715	missense	possibly damaging	0.71
R5611:Reln	UTSW	5	22039665	nonsense	probably null
R5648:Reln	UTSW	5	21998572	missense	probably benign	0.04
R5649:Reln	UTSW	5	21901625	missense	probably benign	0.33
R5744:Reln	UTSW	5	22106083	missense	probably null	0.39
R5782:Reln	UTSW	5	22018056	missense	probably benign	0.01
R5815:Reln	UTSW	5	21947433	missense	probably damaging	0.99
R5838:Reln	UTSW	5	21899113	missense	probably damaging	0.97
R6162:Reln	UTSW	5	21911050	missense	probably damaging	1.00
R6219:Reln	UTSW	5	21948596	missense	probably damaging	1.00
R6259:Reln	UTSW	5	22060333	missense	probably damaging	0.99
R6279:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6299:Reln	UTSW	5	22286944	missense	possibly damaging	0.71
R6300:Reln	UTSW	5	21896841	missense	probably damaging	1.00
R6314:Reln	UTSW	5	22152484	nonsense	probably null
R6351:Reln	UTSW	5	21901663	nonsense	probably null
R6369:Reln	UTSW	5	22051361	missense	probably benign	0.03
R6371:Reln	UTSW	5	21995513	missense	probably benign
R6374:Reln	UTSW	5	22080714	missense	probably benign	0.06
R6425:Reln	UTSW	5	21911020	nonsense	probably null
R6442:Reln	UTSW	5	21932776	missense	probably benign
R6445:Reln	UTSW	5	21919214	missense	probably benign	0.05
R6554:Reln	UTSW	5	21896840	missense	probably damaging	1.00
R6641:Reln	UTSW	5	21929134	missense	probably damaging	1.00
R6768:Reln	UTSW	5	21978907	missense	probably damaging	0.99
R6859:Reln	UTSW	5	22034570	missense	probably damaging	1.00
R6896:Reln	UTSW	5	21899179	missense	probably benign	0.18
R6932:Reln	UTSW	5	21985857	missense	probably benign	0.00
R6948:Reln	UTSW	5	21972035	missense	probably damaging	1.00
R6959:Reln	UTSW	5	21976564	missense	probably damaging	1.00
R7085:Reln	UTSW	5	21915087	nonsense	probably null
R7091:Reln	UTSW	5	21899029	missense	probably null	0.08
R7146:Reln	UTSW	5	22106097	missense	probably damaging	0.97
R7167:Reln	UTSW	5	21942620	missense	probably damaging	1.00
R7190:Reln	UTSW	5	22047947	missense	probably damaging	1.00
R7256:Reln	UTSW	5	21978923	missense	probably benign	0.03
R7393:Reln	UTSW	5	21976351	missense	probably damaging	0.99
R7399:Reln	UTSW	5	22051367	missense	probably damaging	0.99
R7400:Reln	UTSW	5	21971934	missense	probably damaging	0.99
R7426:Reln	UTSW	5	21971953	missense	probably damaging	1.00
R7463:Reln	UTSW	5	22103435	missense	probably damaging	0.98
R7470:Reln	UTSW	5	21942741	missense	probably damaging	0.99
R7473:Reln	UTSW	5	21929127	missense	probably benign	0.25
R7501:Reln	UTSW	5	22227638	missense	possibly damaging	0.91
R7542:Reln	UTSW	5	21955181	missense	probably damaging	1.00
R7544:Reln	UTSW	5	21976278	nonsense	probably null
R7588:Reln	UTSW	5	21885568	missense	probably benign	0.03
R7631:Reln	UTSW	5	21971935	missense	probably damaging	0.97
R7644:Reln	UTSW	5	21978931	missense	probably benign	0.39
R7834:Reln	UTSW	5	22039635	missense	possibly damaging	0.94
R7917:Reln	UTSW	5	22039635	missense	possibly damaging	0.94
R8006:Reln	UTSW	5	21899084	nonsense	probably null
R8062:Reln	UTSW	5	21971992	missense	probably benign	0.00
Z1176:Reln	UTSW	5	21979024	missense	probably damaging	1.00
Z1177:Reln	UTSW	5	21969241	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22004082	missense	probably damaging	0.96
Z1177:Reln	UTSW	5	22154959	missense	probably benign	0.05
Z1177:Reln	UTSW	5	22227636	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAGGCCAAAGGTCAGGATG -3'
(R):5'- CAGAGGAGAGAACATTTGCTGC -3'

Sequencing Primer
(F):5'- CCAAAGGTCAGGATGTAAGTTCCC -3'
(R):5'- GGAGAGAACATTTGCTGCTTAATTAC -3'

Posted On

2019-05-15