Incidental Mutation 'R7135:Tnrc18'
ID552989
Institutional Source Beutler Lab
Gene Symbol Tnrc18
Ensembl Gene ENSMUSG00000039477
Gene Nametrinucleotide repeat containing 18
SynonymsZfp469, EG381742
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.623) question?
Stock #R7135 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location142724661-142817662 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 142787817 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 419 (A419D)
Ref Sequence ENSEMBL: ENSMUSP00000114769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000151477] [ENSMUST00000152247]
Predicted Effect
SMART Domains Protein: ENSMUSP00000114769
Gene: ENSMUSG00000039477
AA Change: A419D

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
low complexity region 240 287 N/A INTRINSIC
low complexity region 369 390 N/A INTRINSIC
low complexity region 457 475 N/A INTRINSIC
low complexity region 623 634 N/A INTRINSIC
coiled coil region 843 876 N/A INTRINSIC
low complexity region 916 930 N/A INTRINSIC
low complexity region 951 970 N/A INTRINSIC
low complexity region 980 993 N/A INTRINSIC
low complexity region 1093 1112 N/A INTRINSIC
low complexity region 1269 1289 N/A INTRINSIC
coiled coil region 1411 1443 N/A INTRINSIC
low complexity region 1477 1493 N/A INTRINSIC
low complexity region 1581 1593 N/A INTRINSIC
low complexity region 1608 1619 N/A INTRINSIC
low complexity region 1735 1752 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000152247
AA Change: A236D
SMART Domains Protein: ENSMUSP00000117651
Gene: ENSMUSG00000039477
AA Change: A236D

DomainStartEndE-ValueType
low complexity region 57 104 N/A INTRINSIC
low complexity region 186 207 N/A INTRINSIC
low complexity region 274 292 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
coiled coil region 660 693 N/A INTRINSIC
low complexity region 733 747 N/A INTRINSIC
low complexity region 768 787 N/A INTRINSIC
low complexity region 797 810 N/A INTRINSIC
low complexity region 910 929 N/A INTRINSIC
low complexity region 1086 1106 N/A INTRINSIC
coiled coil region 1228 1260 N/A INTRINSIC
low complexity region 1294 1310 N/A INTRINSIC
low complexity region 1398 1410 N/A INTRINSIC
low complexity region 1425 1436 N/A INTRINSIC
coiled coil region 1570 1592 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1622 1640 N/A INTRINSIC
low complexity region 1641 1653 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (83/83)
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
AC166344.1 T A 14: 43,300,788 F97I Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dnmt3c C A 2: 153,714,952 probably null Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Oprm1 A T 10: 6,830,203 I171F possibly damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pdlim5 A T 3: 142,311,922 probably null Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Recql5 C T 11: 115,930,672 probably null Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Tnrc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00568:Tnrc18 APN 5 142763037 missense unknown
IGL01732:Tnrc18 APN 5 142772061 missense unknown
IGL01796:Tnrc18 APN 5 142764887 missense possibly damaging 0.88
IGL01868:Tnrc18 APN 5 142771812 missense unknown
IGL02010:Tnrc18 APN 5 142787294 missense unknown
IGL02566:Tnrc18 APN 5 142772313 splice site probably benign
IGL02688:Tnrc18 APN 5 142790172 missense probably damaging 0.96
IGL03052:Tnrc18 UTSW 5 142775219 missense unknown
R0129:Tnrc18 UTSW 5 142765045 splice site probably benign
R0617:Tnrc18 UTSW 5 142776739 missense unknown
R0894:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1056:Tnrc18 UTSW 5 142773859 nonsense probably null
R1084:Tnrc18 UTSW 5 142764767 critical splice donor site probably null
R1131:Tnrc18 UTSW 5 142787208 missense unknown
R1411:Tnrc18 UTSW 5 142765947 missense unknown
R1443:Tnrc18 UTSW 5 142771533 missense unknown
R1681:Tnrc18 UTSW 5 142773817 missense unknown
R1698:Tnrc18 UTSW 5 142788703 missense possibly damaging 0.83
R1795:Tnrc18 UTSW 5 142815114 missense probably benign 0.37
R1903:Tnrc18 UTSW 5 142815140 missense probably damaging 0.99
R1930:Tnrc18 UTSW 5 142776324 missense unknown
R1931:Tnrc18 UTSW 5 142776324 missense unknown
R1941:Tnrc18 UTSW 5 142815150 missense probably damaging 1.00
R2069:Tnrc18 UTSW 5 142766087 missense unknown
R2074:Tnrc18 UTSW 5 142759706 splice site probably null
R2089:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2091:Tnrc18 UTSW 5 142773641 missense unknown
R2182:Tnrc18 UTSW 5 142760061 missense unknown
R2190:Tnrc18 UTSW 5 142775889 missense unknown
R2310:Tnrc18 UTSW 5 142788553 missense probably damaging 0.96
R2372:Tnrc18 UTSW 5 142759704 splice site probably benign
R2445:Tnrc18 UTSW 5 142772115 missense unknown
R3806:Tnrc18 UTSW 5 142787274 missense unknown
R4097:Tnrc18 UTSW 5 142773806 small deletion probably benign
R4153:Tnrc18 UTSW 5 142765992 missense possibly damaging 0.89
R4274:Tnrc18 UTSW 5 142743650 missense unknown
R4520:Tnrc18 UTSW 5 142732150 missense unknown
R4627:Tnrc18 UTSW 5 142740128 missense unknown
R4852:Tnrc18 UTSW 5 142731340 missense probably damaging 0.98
R4873:Tnrc18 UTSW 5 142765177 missense unknown
R4875:Tnrc18 UTSW 5 142765177 missense unknown
R4876:Tnrc18 UTSW 5 142731625 missense unknown
R4936:Tnrc18 UTSW 5 142765977 nonsense probably null
R4942:Tnrc18 UTSW 5 142787982 missense unknown
R4962:Tnrc18 UTSW 5 142739493 missense unknown
R5373:Tnrc18 UTSW 5 142740156 missense unknown
R5374:Tnrc18 UTSW 5 142740156 missense unknown
R5454:Tnrc18 UTSW 5 142771691 missense unknown
R5678:Tnrc18 UTSW 5 142733564 missense unknown
R5826:Tnrc18 UTSW 5 142773747 missense unknown
R5891:Tnrc18 UTSW 5 142815171 missense probably damaging 0.99
R6195:Tnrc18 UTSW 5 142765173 missense unknown
R6296:Tnrc18 UTSW 5 142733576 missense unknown
R6358:Tnrc18 UTSW 5 142727981 missense probably damaging 0.99
R6452:Tnrc18 UTSW 5 142727012 missense probably damaging 1.00
R6498:Tnrc18 UTSW 5 142732168 missense unknown
R6711:Tnrc18 UTSW 5 142787790 missense unknown
R6782:Tnrc18 UTSW 5 142787308 missense unknown
R6863:Tnrc18 UTSW 5 142815197 missense probably damaging 1.00
R6894:Tnrc18 UTSW 5 142760049 missense unknown
R6970:Tnrc18 UTSW 5 142727989 missense probably damaging 0.99
R7053:Tnrc18 UTSW 5 142787229 missense unknown
R7756:Tnrc18 UTSW 5 142787152 missense
R7902:Tnrc18 UTSW 5 142772147 missense
R7985:Tnrc18 UTSW 5 142772147 missense
R8039:Tnrc18 UTSW 5 142732052 missense unknown
R8053:Tnrc18 UTSW 5 142750630 missense unknown
RF022:Tnrc18 UTSW 5 142773630 missense
Z1177:Tnrc18 UTSW 5 142773888 missense
Predicted Primers PCR Primer
(F):5'- TTTGATGAGGCTCTGCATAGC -3'
(R):5'- TTCTGCGGGAGAAAAGCTCG -3'

Sequencing Primer
(F):5'- TGCATAGCAGAGGCCTCTC -3'
(R):5'- GGAGAAAAGCTCGGTCATCC -3'
Posted On2019-05-15