Incidental Mutation 'R7135:Wdr11'
ID553001
Institutional Source Beutler Lab
Gene Symbol Wdr11
Ensembl Gene ENSMUSG00000042055
Gene NameWD repeat domain 11
SynonymsBrwd2, Wdr11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R7135 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location129591863-129635738 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129628106 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 872 (S872P)
Ref Sequence ENSEMBL: ENSMUSP00000081567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084519]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084519
AA Change: S872P

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081567
Gene: ENSMUSG00000042055
AA Change: S872P

DomainStartEndE-ValueType
WD40 50 99 2e-1 SMART
WD40 102 145 2.84e2 SMART
low complexity region 189 200 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 454 465 N/A INTRINSIC
WD40 552 595 4.42e1 SMART
WD40 696 735 1.66e0 SMART
WD40 737 777 1.43e1 SMART
WD40 780 821 1.38e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136560
Predicted Effect probably benign
Transcript: ENSMUST00000148752
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is located in the chromosome 10q25-26 region, which is frequently deleted in gliomas and tumors of other tissues, and is disrupted by the t(10;19) translocation rearrangement in glioblastoma cells. The gene location suggests that it is a candidate gene for the tumor suppressor locus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
AC166344.1 T A 14: 43,300,788 F97I Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dnmt3c C A 2: 153,714,952 probably null Het
Dsp A T 13: 38,179,073 Y443F probably damaging Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Oprm1 A T 10: 6,830,203 I171F possibly damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pdlim5 A T 3: 142,311,922 probably null Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Recql5 C T 11: 115,930,672 probably null Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Wdr11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Wdr11 APN 7 129593093 splice site probably null
IGL01121:Wdr11 APN 7 129628022 missense probably benign 0.02
IGL01385:Wdr11 APN 7 129607913 missense probably benign
IGL01923:Wdr11 APN 7 129632322 critical splice acceptor site probably null
IGL02274:Wdr11 APN 7 129631172 critical splice acceptor site probably null
IGL02894:Wdr11 APN 7 129631166 splice site probably benign
IGL02927:Wdr11 APN 7 129607098 critical splice donor site probably null
IGL03008:Wdr11 APN 7 129606991 unclassified probably benign
IGL03026:Wdr11 APN 7 129624336 missense probably damaging 1.00
IGL03354:Wdr11 APN 7 129625302 missense probably benign 0.01
IGL03379:Wdr11 APN 7 129599123 missense probably damaging 1.00
propeller UTSW 7 129606675 missense possibly damaging 0.91
R0003:Wdr11 UTSW 7 129599061 missense probably damaging 1.00
R0928:Wdr11 UTSW 7 129606653 missense probably damaging 1.00
R1170:Wdr11 UTSW 7 129607107 unclassified probably benign
R1645:Wdr11 UTSW 7 129613889 missense probably benign 0.29
R1908:Wdr11 UTSW 7 129605230 missense possibly damaging 0.60
R1938:Wdr11 UTSW 7 129606607 missense probably benign 0.08
R2122:Wdr11 UTSW 7 129631766 missense probably damaging 1.00
R2148:Wdr11 UTSW 7 129629083 intron probably null
R2240:Wdr11 UTSW 7 129605694 critical splice acceptor site probably null
R2362:Wdr11 UTSW 7 129634836 missense probably benign 0.05
R3774:Wdr11 UTSW 7 129631693 splice site probably null
R4297:Wdr11 UTSW 7 129625186 missense probably benign 0.18
R4546:Wdr11 UTSW 7 129629005 missense probably damaging 1.00
R4787:Wdr11 UTSW 7 129608934 splice site probably benign
R4789:Wdr11 UTSW 7 129618670 nonsense probably null
R4807:Wdr11 UTSW 7 129628022 missense probably benign 0.02
R4855:Wdr11 UTSW 7 129600434 splice site probably null
R4898:Wdr11 UTSW 7 129633721 missense probably benign
R5022:Wdr11 UTSW 7 129624711 missense probably benign 0.10
R5326:Wdr11 UTSW 7 129625249 missense probably damaging 1.00
R5398:Wdr11 UTSW 7 129631232 missense probably damaging 1.00
R6120:Wdr11 UTSW 7 129624791 missense probably damaging 0.99
R6136:Wdr11 UTSW 7 129618703 missense possibly damaging 0.86
R6280:Wdr11 UTSW 7 129599106 nonsense probably null
R6352:Wdr11 UTSW 7 129606675 missense possibly damaging 0.91
R6432:Wdr11 UTSW 7 129606518 missense possibly damaging 0.83
R6766:Wdr11 UTSW 7 129624312 missense probably benign 0.02
R6911:Wdr11 UTSW 7 129607095 missense probably benign 0.28
R7151:Wdr11 UTSW 7 129606652 missense probably damaging 1.00
R7463:Wdr11 UTSW 7 129607086 missense probably damaging 0.99
R7503:Wdr11 UTSW 7 129603110 missense probably benign
Z1177:Wdr11 UTSW 7 129607878 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGATAGCTGAGACGTTGCTG -3'
(R):5'- AGCATCCTATGACCCTGCAG -3'

Sequencing Primer
(F):5'- GCTGAGGCATGAAAGTTCATTTTAC -3'
(R):5'- CCACGGTGGTGCAAACAG -3'
Posted On2019-05-15