Mutagenetix > Incidental Mutations

Incidental Mutation 'R7135:Msr1'

553002

Institutional Source

Beutler Lab

Gene Symbol

Msr1

Ensembl Gene

ENSMUSG00000025044

Gene Name

macrophage scavenger receptor 1

Synonyms

SR-AI, MSR-A, SR-AII, Scara1, Scvr, MRS-A

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_001113326; MGI:98257

Is this an essential gene?

Probably non essential (E-score: 0.062) question?

Stock #

R7135 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

39581685-39642673 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 39589424 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 370 (V370E)

Ref Sequence

ENSEMBL: ENSMUSP00000026021 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026021]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000026021
AA Change: V370E

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000026021
Gene: ENSMUSG00000025044
AA Change: V370E

Domain	Start	End	E-Value	Type
transmembrane domain	58	80	N/A	INTRINSIC
Pfam:Macscav_rec	125	173	1.5e-28	PFAM
coiled coil region	209	259	N/A	INTRINSIC
Pfam:Collagen	275	330	3.2e-11	PFAM
Pfam:Collagen	295	353	4.8e-10	PFAM
SR	357	457	5.68e-56	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and have been implicated in many macrophage-associated physiological and pathological processes including atherosclerosis, Alzheimer's disease, and host defense. The isoforms type 1 and type 2 are functional receptors and are able to mediate the endocytosis of modified low density lipoproteins (LDLs). The isoform type 3 does not internalize modified LDL (acetyl-LDL) despite having the domain shown to mediate this function in the types 1 and 2 isoforms. It has an altered intracellular processing and is trapped within the endoplasmic reticulum, making it unable to perform endocytosis. The isoform type 3 can inhibit the function of isoforms type 1 and type 2 when co-expressed, indicating a dominant negative effect and suggesting a mechanism for regulation of scavenger receptor activity in macrophages. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal uptake and degradation of acetylated low density lipoproteins by macrophages, increased interleukin-12 secretion in response to CpG oligodeoxynucleotide administration, and increased bacterial and viral infection induced morbidity/mortality. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016G14Rik	T	C	13: 24,741,506	S78P	probably benign	Het
Aars2	T	A	17: 45,508,961	Y221*	probably null	Het
AC166344.1	T	A	14: 43,300,788	F97I		Het
Ankmy2	T	C	12: 36,196,312	S412P	probably benign	Het
Ap1s3	T	C	1: 79,609,202	T144A	probably benign	Het
Asb3	T	A	11: 30,998,501	L59*	probably null	Het
Asxl3	G	T	18: 22,517,701	G916*	probably null	Het
Asxl3	G	C	18: 22,517,702	G916A	probably damaging	Het
Birc2	A	C	9: 7,818,761	F610V	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccdc162	A	G	10: 41,673,859	S343P	probably benign	Het
Ccnk	T	A	12: 108,186,475	L17Q	probably damaging	Het
Cd59b	G	A	2: 104,084,447	W63*	probably null	Het
Chrm3	C	T	13: 9,877,801	V400I	probably benign	Het
Crb1	C	A	1: 139,243,367	V762F	probably damaging	Het
Cspp1	C	T	1: 10,088,936	T529I	possibly damaging	Het
Cttnbp2	A	G	6: 18,448,447	I71T	possibly damaging	Het
Cyb561	C	A	11: 105,935,567	G90V	probably damaging	Het
Cyld	T	A	8: 88,744,892	D804E	possibly damaging	Het
Ddx31	G	A	2: 28,848,306	V160I	probably benign	Het
Dgkg	T	C	16: 22,500,382	D643G	probably damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnah12	T	G	14: 26,801,413	I1953S	probably damaging	Het
Dnah7b	T	C	1: 46,139,710	W848R	probably damaging	Het
Dnah7c	C	T	1: 46,533,208	T947M	probably damaging	Het
Dnmt3c	C	A	2: 153,714,952		probably null	Het
Dsp	A	T	13: 38,179,073	Y443F	probably damaging	Het
Espl1	T	A	15: 102,319,524	C1603*	probably null	Het
Faiml	G	T	9: 99,234,443	R65S	probably benign	Het
Gfpt2	T	C	11: 49,804,955	I4T	probably damaging	Het
Gm10376	T	A	14: 43,010,493	M179L	probably benign	Het
Gm13084	A	T	4: 143,810,663	L366Q	probably damaging	Het
Gm4302	T	A	10: 100,341,727	M291K	unknown	Het
Gm8906	C	T	5: 11,505,231	P83S	probably damaging	Het
Gnb1l	T	A	16: 18,545,168	D154E	probably benign	Het
Igkv10-94	T	C	6: 68,704,743	R38G	possibly damaging	Het
Inmt	A	T	6: 55,171,028	Y205*	probably null	Het
Krba1	A	G	6: 48,416,299	Q1049R	probably benign	Het
Lpxn	T	A	19: 12,833,319	C376S	probably damaging	Het
Lrrc52	T	A	1: 167,466,450	I89F	probably damaging	Het
Map9	A	T	3: 82,363,458	T110S	probably benign	Het
Mccc1	T	C	3: 35,995,818	Y75C	probably damaging	Het
Mff	T	A	1: 82,747,091	L203*	probably null	Het
Micall1	C	A	15: 79,109,424	D47E	unknown	Het
Mink1	T	C	11: 70,603,503	F243S	probably damaging	Het
Mlycd	C	T	8: 119,402,477	R228W	probably damaging	Het
Naip6	T	C	13: 100,300,419	E532G	probably damaging	Het
Nepn	G	A	10: 52,391,719	C27Y	probably damaging	Het
Ninl	T	C	2: 150,955,604	H592R	probably benign	Het
Nr4a2	A	G	2: 57,112,249	M64T	possibly damaging	Het
Olfr1279	T	A	2: 111,307,020	F272I	probably benign	Het
Olfr484	T	C	7: 108,124,574	K230E	probably damaging	Het
Oprm1	A	T	10: 6,830,203	I171F	possibly damaging	Het
Pcbp1	A	T	6: 86,525,506	M137K	possibly damaging	Het
Pcf11	A	T	7: 92,657,316	S1215T	probably benign	Het
Pdlim5	A	T	3: 142,311,922		probably null	Het
Pecam1	T	C	11: 106,689,031	I402V	probably damaging	Het
Pex12	T	C	11: 83,297,642	T176A	probably benign	Het
Phf3	T	C	1: 30,831,109	K286R	possibly damaging	Het
Pik3ap1	T	A	19: 41,332,321	D153V	probably damaging	Het
Pkhd1l1	T	A	15: 44,584,978		probably null	Het
Plekhn1	A	G	4: 156,223,335	V378A	probably benign	Het
Ptprm	A	T	17: 66,944,288	D531E	possibly damaging	Het
Pum2	A	T	12: 8,728,952	Q508L	possibly damaging	Het
Rad54l	A	G	4: 116,105,830	S324P	probably damaging	Het
Recql5	C	T	11: 115,930,672		probably null	Het
Reln	A	T	5: 21,976,596	V1763D	possibly damaging	Het
Rp1	T	C	1: 4,348,168	N907S	possibly damaging	Het
Scaf11	T	A	15: 96,420,328	N452Y	possibly damaging	Het
Scgb2b3	T	A	7: 31,360,214	H45L	possibly damaging	Het
Sim1	A	G	10: 50,895,927	T11A	probably damaging	Het
Slc5a12	T	A	2: 110,616,714	M189K	possibly damaging	Het
Slco2b1	C	T	7: 99,695,063	G10S	probably null	Het
Stxbp3	A	G	3: 108,800,755	L410P	probably damaging	Het
Sugct	T	C	13: 17,302,009	N297D	probably benign	Het
Syne1	A	G	10: 5,233,409	I4132T	probably benign	Het
Teddm1b	A	T	1: 153,875,166	L240F	probably damaging	Het
Tlr5	C	A	1: 182,975,523	D797E	possibly damaging	Het
Tmprss13	G	T	9: 45,338,345	G327C	probably damaging	Het
Tnrc18	G	T	5: 142,787,817	A419D		Het
Ttc28	T	C	5: 111,280,007	Y1790H	probably damaging	Het
Vmn1r125	T	G	7: 21,272,402	M75R	probably damaging	Het
Vwa3a	T	A	7: 120,773,030	D276E	possibly damaging	Het
Wdfy3	C	T	5: 101,915,437	V1322M	probably damaging	Het
Wdr11	T	C	7: 129,628,106	S872P	possibly damaging	Het
Zc3h13	T	C	14: 75,321,721	S357P	unknown	Het

Other mutations in Msr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01535:Msr1	APN	8	39611673	missense	probably benign	0.42
IGL02047:Msr1	APN	8	39623960	missense	probably benign	0.03
IGL02218:Msr1	APN	8	39589316	missense	possibly damaging	0.51
IGL02347:Msr1	APN	8	39632737	missense	probably damaging	1.00
IGL02546:Msr1	APN	8	39615747	missense	probably benign
IGL02707:Msr1	APN	8	39632829	splice site	probably benign
IGL03340:Msr1	APN	8	39620007	missense	possibly damaging	0.53
R0349:Msr1	UTSW	8	39581827	missense	probably damaging	1.00
R0378:Msr1	UTSW	8	39589382	missense	possibly damaging	0.92
R0633:Msr1	UTSW	8	39620000	missense	probably damaging	0.99
R1386:Msr1	UTSW	8	39589293	nonsense	probably null
R1807:Msr1	UTSW	8	39619907	missense	probably benign	0.33
R2039:Msr1	UTSW	8	39589377	missense	probably damaging	1.00
R2174:Msr1	UTSW	8	39631340	missense	probably damaging	1.00
R2291:Msr1	UTSW	8	39624222	missense	probably benign	0.03
R3983:Msr1	UTSW	8	39620018	missense	possibly damaging	0.89
R4807:Msr1	UTSW	8	39642627	start gained	probably benign
R4921:Msr1	UTSW	8	39624251	missense	possibly damaging	0.72
R5055:Msr1	UTSW	8	39623956	missense	possibly damaging	0.78
R5567:Msr1	UTSW	8	39611719	missense	probably benign
R5570:Msr1	UTSW	8	39611719	missense	probably benign
R5871:Msr1	UTSW	8	39611652	missense	probably damaging	0.97
R5914:Msr1	UTSW	8	39581827	missense	probably damaging	1.00
R6141:Msr1	UTSW	8	39631319	missense	probably damaging	1.00
R6429:Msr1	UTSW	8	39615817	missense	probably damaging	0.99
R6519:Msr1	UTSW	8	39624221	missense	probably benign
R6527:Msr1	UTSW	8	39624233	missense	possibly damaging	0.72
R6842:Msr1	UTSW	8	39632825	missense	probably benign	0.01
R7006:Msr1	UTSW	8	39589382	missense	probably damaging	0.99
R7047:Msr1	UTSW	8	39642616	missense	possibly damaging	0.92
R7552:Msr1	UTSW	8	39623962	missense	probably benign	0.19
R7837:Msr1	UTSW	8	39581832	missense	probably damaging	0.99
Z1177:Msr1	UTSW	8	39631302	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGTGCTCATGAAGTTCTCAAAAC -3'
(R):5'- TTGCAGTTAAACTCTTGACCAGTAG -3'

Sequencing Primer
(F):5'- CTCTCTTGTGCACAGCTA -3'
(R):5'- TGGGAAGGGATGGGGTG -3'

Posted On

2019-05-15