Mutagenetix > Incidental Mutations

Incidental Mutation 'R7135:Cyld'

553003

Institutional Source

Beutler Lab

Gene Symbol

Cyld

Ensembl Gene

ENSMUSG00000036712

Gene Name

CYLD lysine 63 deubiquitinase

Synonyms

CYLD1, C130039D01Rik, 2900009M21Rik, 2010013M14Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7135 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

88697028-88751945 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88744892 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 804 (D804E)

Ref Sequence

ENSEMBL: ENSMUSP00000039834 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043526] [ENSMUST00000098519] [ENSMUST00000109626] [ENSMUST00000209206] [ENSMUST00000209532] [ENSMUST00000209559] [ENSMUST00000211554]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000043526
AA Change: D804E

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000039834
Gene: ENSMUSG00000036712
AA Change: D804E

Domain	Start	End	E-Value	Type
low complexity region	109	120	N/A	INTRINSIC
CAP_GLY	127	203	3.2e-18	SMART
CAP_GLY	232	303	5.37e-11	SMART
low complexity region	397	411	N/A	INTRINSIC
CAP_GLY	471	539	2.68e-20	SMART
Pfam:UCH	591	891	1.7e-12	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000098519
AA Change: D804E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000096119
Gene: ENSMUSG00000036712
AA Change: D804E

Domain	Start	End	E-Value	Type
low complexity region	109	120	N/A	INTRINSIC
CAP_GLY	127	203	3.2e-18	SMART
CAP_GLY	232	303	5.37e-11	SMART
Pfam:CYLD_phos_site	307	470	6.5e-88	PFAM
CAP_GLY	471	539	2.68e-20	SMART
Pfam:UCH	590	893	2.1e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000109626
AA Change: D801E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000105254
Gene: ENSMUSG00000036712
AA Change: D801E

Domain	Start	End	E-Value	Type
low complexity region	109	120	N/A	INTRINSIC
CAP_GLY	127	203	3.2e-18	SMART
CAP_GLY	232	303	5.37e-11	SMART
Pfam:CYLD_phos_site	304	467	2.5e-88	PFAM
CAP_GLY	468	536	2.68e-20	SMART
Pfam:UCH	587	890	2e-14	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000209206
AA Change: D619E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000209532
AA Change: D804E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably damaging
Transcript: ENSMUST00000209559
AA Change: D801E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000211554
AA Change: D801E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: This gene encodes a protein that is a member of the ubiquitin C-terminal hydrolase subfamily of the deubiquitinating enzyme family. Members of this family catalyze the removal of ubiquitin from a substrate or another ubiquitin molecule and thereby play important roles in regulating signaling pathways, recycling ubiquitin and regulating protein stability. This protein removes ubiquitin from K-63-linked ubiquitin chains from proteins involved in NF-kappaB signaling and thus acts as a negative regulator of this pathway. In humans mutations in this gene have been associated with cylindromatosis, an autosomal dominant predisposition to tumors of skin appendages. In mouse deficiency of this gene impairs thymocyte development and increases susceptibility to skin and colon tumors. A pseudogene of this gene has been identified on chromosome 1. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jan 2013]
PHENOTYPE: Various knockout models with different exon deletions have been created. Observed phenotypes include altered T cell and B cell development, susceptibility to induced skin tumors, resistance to lethal lung infection, high colon tumor incidence, kinky tails, and neonatal death due to lung dysfunction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016G14Rik	T	C	13: 24,741,506	S78P	probably benign	Het
Aars2	T	A	17: 45,508,961	Y221*	probably null	Het
AC166344.1	T	A	14: 43,300,788	F97I		Het
Ankmy2	T	C	12: 36,196,312	S412P	probably benign	Het
Ap1s3	T	C	1: 79,609,202	T144A	probably benign	Het
Asb3	T	A	11: 30,998,501	L59*	probably null	Het
Asxl3	G	T	18: 22,517,701	G916*	probably null	Het
Asxl3	G	C	18: 22,517,702	G916A	probably damaging	Het
Birc2	A	C	9: 7,818,761	F610V	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccdc162	A	G	10: 41,673,859	S343P	probably benign	Het
Ccnk	T	A	12: 108,186,475	L17Q	probably damaging	Het
Cd59b	G	A	2: 104,084,447	W63*	probably null	Het
Chrm3	C	T	13: 9,877,801	V400I	probably benign	Het
Crb1	C	A	1: 139,243,367	V762F	probably damaging	Het
Cspp1	C	T	1: 10,088,936	T529I	possibly damaging	Het
Cttnbp2	A	G	6: 18,448,447	I71T	possibly damaging	Het
Cyb561	C	A	11: 105,935,567	G90V	probably damaging	Het
Ddx31	G	A	2: 28,848,306	V160I	probably benign	Het
Dgkg	T	C	16: 22,500,382	D643G	probably damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnah12	T	G	14: 26,801,413	I1953S	probably damaging	Het
Dnah7b	T	C	1: 46,139,710	W848R	probably damaging	Het
Dnah7c	C	T	1: 46,533,208	T947M	probably damaging	Het
Dnmt3c	C	A	2: 153,714,952		probably null	Het
Dsp	A	T	13: 38,179,073	Y443F	probably damaging	Het
Espl1	T	A	15: 102,319,524	C1603*	probably null	Het
Faiml	G	T	9: 99,234,443	R65S	probably benign	Het
Gfpt2	T	C	11: 49,804,955	I4T	probably damaging	Het
Gm10376	T	A	14: 43,010,493	M179L	probably benign	Het
Gm13084	A	T	4: 143,810,663	L366Q	probably damaging	Het
Gm4302	T	A	10: 100,341,727	M291K	unknown	Het
Gm8906	C	T	5: 11,505,231	P83S	probably damaging	Het
Gnb1l	T	A	16: 18,545,168	D154E	probably benign	Het
Igkv10-94	T	C	6: 68,704,743	R38G	possibly damaging	Het
Inmt	A	T	6: 55,171,028	Y205*	probably null	Het
Krba1	A	G	6: 48,416,299	Q1049R	probably benign	Het
Lpxn	T	A	19: 12,833,319	C376S	probably damaging	Het
Lrrc52	T	A	1: 167,466,450	I89F	probably damaging	Het
Map9	A	T	3: 82,363,458	T110S	probably benign	Het
Mccc1	T	C	3: 35,995,818	Y75C	probably damaging	Het
Mff	T	A	1: 82,747,091	L203*	probably null	Het
Micall1	C	A	15: 79,109,424	D47E	unknown	Het
Mink1	T	C	11: 70,603,503	F243S	probably damaging	Het
Mlycd	C	T	8: 119,402,477	R228W	probably damaging	Het
Msr1	A	T	8: 39,589,424	V370E	possibly damaging	Het
Naip6	T	C	13: 100,300,419	E532G	probably damaging	Het
Nepn	G	A	10: 52,391,719	C27Y	probably damaging	Het
Ninl	T	C	2: 150,955,604	H592R	probably benign	Het
Nr4a2	A	G	2: 57,112,249	M64T	possibly damaging	Het
Olfr1279	T	A	2: 111,307,020	F272I	probably benign	Het
Olfr484	T	C	7: 108,124,574	K230E	probably damaging	Het
Oprm1	A	T	10: 6,830,203	I171F	possibly damaging	Het
Pcbp1	A	T	6: 86,525,506	M137K	possibly damaging	Het
Pcf11	A	T	7: 92,657,316	S1215T	probably benign	Het
Pdlim5	A	T	3: 142,311,922		probably null	Het
Pecam1	T	C	11: 106,689,031	I402V	probably damaging	Het
Pex12	T	C	11: 83,297,642	T176A	probably benign	Het
Phf3	T	C	1: 30,831,109	K286R	possibly damaging	Het
Pik3ap1	T	A	19: 41,332,321	D153V	probably damaging	Het
Pkhd1l1	T	A	15: 44,584,978		probably null	Het
Plekhn1	A	G	4: 156,223,335	V378A	probably benign	Het
Ptprm	A	T	17: 66,944,288	D531E	possibly damaging	Het
Pum2	A	T	12: 8,728,952	Q508L	possibly damaging	Het
Rad54l	A	G	4: 116,105,830	S324P	probably damaging	Het
Recql5	C	T	11: 115,930,672		probably null	Het
Reln	A	T	5: 21,976,596	V1763D	possibly damaging	Het
Rp1	T	C	1: 4,348,168	N907S	possibly damaging	Het
Scaf11	T	A	15: 96,420,328	N452Y	possibly damaging	Het
Scgb2b3	T	A	7: 31,360,214	H45L	possibly damaging	Het
Sim1	A	G	10: 50,895,927	T11A	probably damaging	Het
Slc5a12	T	A	2: 110,616,714	M189K	possibly damaging	Het
Slco2b1	C	T	7: 99,695,063	G10S	probably null	Het
Stxbp3	A	G	3: 108,800,755	L410P	probably damaging	Het
Sugct	T	C	13: 17,302,009	N297D	probably benign	Het
Syne1	A	G	10: 5,233,409	I4132T	probably benign	Het
Teddm1b	A	T	1: 153,875,166	L240F	probably damaging	Het
Tlr5	C	A	1: 182,975,523	D797E	possibly damaging	Het
Tmprss13	G	T	9: 45,338,345	G327C	probably damaging	Het
Tnrc18	G	T	5: 142,787,817	A419D		Het
Ttc28	T	C	5: 111,280,007	Y1790H	probably damaging	Het
Vmn1r125	T	G	7: 21,272,402	M75R	probably damaging	Het
Vwa3a	T	A	7: 120,773,030	D276E	possibly damaging	Het
Wdfy3	C	T	5: 101,915,437	V1322M	probably damaging	Het
Wdr11	T	C	7: 129,628,106	S872P	possibly damaging	Het
Zc3h13	T	C	14: 75,321,721	S357P	unknown	Het

Other mutations in Cyld

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Cyld	APN	8	88705457	missense	probably benign	0.41
IGL00481:Cyld	APN	8	88707290	missense	probably damaging	1.00
IGL01013:Cyld	APN	8	88742362	missense	probably damaging	1.00
IGL01653:Cyld	APN	8	88741370	missense	probably damaging	1.00
IGL01700:Cyld	APN	8	88707099	missense	probably damaging	0.99
IGL01845:Cyld	APN	8	88705775	nonsense	probably null
IGL02366:Cyld	APN	8	88729753	missense	probably damaging	1.00
IGL02379:Cyld	APN	8	88744928	nonsense	probably null
IGL02506:Cyld	APN	8	88729590	missense	possibly damaging	0.86
IGL02563:Cyld	APN	8	88735894	missense	probably damaging	1.00
IGL02565:Cyld	APN	8	88741291	missense	probably damaging	1.00
IGL02814:Cyld	APN	8	88744897	missense	probably benign	0.29
PIT4131001:Cyld	UTSW	8	88746915	missense	probably damaging	0.98
R0101:Cyld	UTSW	8	88718300	critical splice donor site	probably null
R0122:Cyld	UTSW	8	88742292	missense	probably damaging	1.00
R0529:Cyld	UTSW	8	88729759	missense	probably benign	0.34
R0838:Cyld	UTSW	8	88741350	missense	probably benign	0.15
R1589:Cyld	UTSW	8	88709990	missense	possibly damaging	0.84
R1732:Cyld	UTSW	8	88731667	splice site	probably benign
R2029:Cyld	UTSW	8	88745312	missense	probably benign	0.09
R3701:Cyld	UTSW	8	88729551	missense	probably benign
R3798:Cyld	UTSW	8	88734930	missense	probably damaging	1.00
R4243:Cyld	UTSW	8	88730755	nonsense	probably null
R4244:Cyld	UTSW	8	88730755	nonsense	probably null
R4260:Cyld	UTSW	8	88741391	missense	probably damaging	1.00
R4458:Cyld	UTSW	8	88719301	missense	probably benign	0.24
R4551:Cyld	UTSW	8	88707134	missense	possibly damaging	0.95
R4718:Cyld	UTSW	8	88742305	missense	probably damaging	0.99
R4735:Cyld	UTSW	8	88729650	missense	probably damaging	1.00
R4753:Cyld	UTSW	8	88744816	splice site	probably null
R4966:Cyld	UTSW	8	88742301	missense	possibly damaging	0.55
R4975:Cyld	UTSW	8	88707232	missense	probably benign
R5375:Cyld	UTSW	8	88733036	missense	possibly damaging	0.77
R5647:Cyld	UTSW	8	88734926	missense	probably benign	0.10
R5741:Cyld	UTSW	8	88744846	missense	probably damaging	1.00
R5837:Cyld	UTSW	8	88741404	missense	probably damaging	0.99
R5931:Cyld	UTSW	8	88729842	splice site	probably null
R5970:Cyld	UTSW	8	88732993	missense	probably damaging	0.99
R5992:Cyld	UTSW	8	88733053	missense	probably damaging	1.00
R6165:Cyld	UTSW	8	88746933	missense	possibly damaging	0.88
R7667:Cyld	UTSW	8	88742302	missense	probably benign	0.01
R7858:Cyld	UTSW	8	88709988	missense	probably damaging	0.98
R7912:Cyld	UTSW	8	88734897	missense	probably damaging	1.00
R7941:Cyld	UTSW	8	88709988	missense	probably damaging	0.98
R7993:Cyld	UTSW	8	88734897	missense	probably damaging	1.00
RF016:Cyld	UTSW	8	88705441	nonsense	probably null
X0010:Cyld	UTSW	8	88746912	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGAATCACCGTCCTTGAC -3'
(R):5'- GCCCAGCTCTTATAATCACAGC -3'

Sequencing Primer
(F):5'- CTTGACCTCAAGCTGTACTACAG -3'
(R):5'- ACAGCCAAGTATTTCTCTCTCACAC -3'

Posted On

2019-05-15