Mutagenetix > Incidental Mutation

Incidental Mutation 'R7135:Dsp'

553025

Institutional Source

Beutler Lab

Gene Symbol

Dsp

Ensembl Gene

ENSMUSG00000054889

Gene Name

desmoplakin

Synonyms

5730453H04Rik, DP, 2300002E22Rik

MMRRC Submission

045247-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7135 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

38151294-38198577 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38179073 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 443 (Y443F)

Ref Sequence

ENSEMBL: ENSMUSP00000115062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000124830
AA Change: Y443F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: Y443F

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-96	BLAST
Blast:SPEC	783	894	4e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1370	N/A	INTRINSIC
coiled coil region	1394	1956	N/A	INTRINSIC
low complexity region	1997	2011	N/A	INTRINSIC
PLEC	2021	2057	3.33e-1	SMART
PLEC	2058	2095	3.76e-9	SMART
PLEC	2096	2133	4.09e-10	SMART
PLEC	2134	2171	2.09e-7	SMART
PLEC	2175	2209	4.83e1	SMART
PLEC	2210	2245	5.67e1	SMART
PLEC	2263	2300	1.22e-8	SMART
PLEC	2301	2338	1.16e-9	SMART
PLEC	2339	2376	1.12e-7	SMART
PLEC	2377	2414	1.56e-6	SMART
PLEC	2418	2452	1.42e0	SMART
PLEC	2468	2505	3.7e-8	SMART
low complexity region	2507	2517	N/A	INTRINSIC
PLEC	2519	2556	3.73e-4	SMART
low complexity region	2577	2593	N/A	INTRINSIC
PLEC	2622	2659	1.46e-6	SMART
PLEC	2660	2697	6.69e-15	SMART
PLEC	2698	2735	1.98e2	SMART
PLEC	2736	2773	2.35e-10	SMART
PLEC	2774	2811	1.39e-3	SMART
low complexity region	2835	2860	N/A	INTRINSIC
low complexity region	2867	2879	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000127906
AA Change: Y443F

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: Y443F

Domain	Start	End	E-Value	Type
Blast:SPEC	193	282	2e-51	BLAST
SPEC	285	385	6.03e-2	SMART
Blast:SPEC	391	557	1e-95	BLAST
Blast:SPEC	783	894	3e-34	BLAST
SPEC	901	1030	1.39e0	SMART
coiled coil region	1033	1357	N/A	INTRINSIC
low complexity region	1398	1412	N/A	INTRINSIC
PLEC	1422	1458	3.33e-1	SMART
PLEC	1459	1496	3.76e-9	SMART
PLEC	1497	1534	4.09e-10	SMART
PLEC	1535	1572	2.09e-7	SMART
PLEC	1576	1610	4.83e1	SMART
PLEC	1611	1646	5.67e1	SMART
PLEC	1664	1701	1.22e-8	SMART
PLEC	1702	1739	1.16e-9	SMART
PLEC	1740	1777	1.12e-7	SMART
PLEC	1778	1815	1.56e-6	SMART
PLEC	1819	1853	1.42e0	SMART
PLEC	1869	1906	3.7e-8	SMART
low complexity region	1908	1918	N/A	INTRINSIC
PLEC	1920	1957	3.73e-4	SMART
low complexity region	1978	1994	N/A	INTRINSIC
PLEC	2023	2060	1.46e-6	SMART
PLEC	2061	2098	6.69e-15	SMART
PLEC	2099	2136	1.98e2	SMART
PLEC	2137	2174	2.35e-10	SMART
PLEC	2175	2212	1.39e-3	SMART
low complexity region	2236	2261	N/A	INTRINSIC
low complexity region	2268	2280	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016G14Rik	T	C	13: 24,741,506 (GRCm38)	S78P	probably benign	Het
Aars2	T	A	17: 45,508,961 (GRCm38)	Y221*	probably null	Het
AC166344.1	T	A	14: 43,300,788 (GRCm38)	F97I		Het
Ankmy2	T	C	12: 36,196,312 (GRCm38)	S412P	probably benign	Het
Ap1s3	T	C	1: 79,609,202 (GRCm38)	T144A	probably benign	Het
Asb3	T	A	11: 30,998,501 (GRCm38)	L59*	probably null	Het
Asxl3	G	C	18: 22,517,702 (GRCm38)	G916A	probably damaging	Het
Asxl3	G	T	18: 22,517,701 (GRCm38)	G916*	probably null	Het
Birc2	A	C	9: 7,818,761 (GRCm38)	F610V	probably damaging	Het
Camk4	G	A	18: 33,107,943 (GRCm38)		probably null	Het
Ccdc162	A	G	10: 41,673,859 (GRCm38)	S343P	probably benign	Het
Ccnk	T	A	12: 108,186,475 (GRCm38)	L17Q	probably damaging	Het
Cd59b	G	A	2: 104,084,447 (GRCm38)	W63*	probably null	Het
Chrm3	C	T	13: 9,877,801 (GRCm38)	V400I	probably benign	Het
Crb1	C	A	1: 139,243,367 (GRCm38)	V762F	probably damaging	Het
Cspp1	C	T	1: 10,088,936 (GRCm38)	T529I	possibly damaging	Het
Cttnbp2	A	G	6: 18,448,447 (GRCm38)	I71T	possibly damaging	Het
Cyb561	C	A	11: 105,935,567 (GRCm38)	G90V	probably damaging	Het
Cyld	T	A	8: 88,744,892 (GRCm38)	D804E	possibly damaging	Het
Ddx31	G	A	2: 28,848,306 (GRCm38)	V160I	probably benign	Het
Dgkg	T	C	16: 22,500,382 (GRCm38)	D643G	probably damaging	Het
Dnah12	G	A	14: 26,778,912 (GRCm38)		probably null	Het
Dnah12	T	G	14: 26,801,413 (GRCm38)	I1953S	probably damaging	Het
Dnah7b	T	C	1: 46,139,710 (GRCm38)	W848R	probably damaging	Het
Dnah7c	C	T	1: 46,533,208 (GRCm38)	T947M	probably damaging	Het
Dnmt3c	C	A	2: 153,714,952 (GRCm38)		probably null	Het
Espl1	T	A	15: 102,319,524 (GRCm38)	C1603*	probably null	Het
Faiml	G	T	9: 99,234,443 (GRCm38)	R65S	probably benign	Het
Gfpt2	T	C	11: 49,804,955 (GRCm38)	I4T	probably damaging	Het
Gm10376	T	A	14: 43,010,493 (GRCm38)	M179L	probably benign	Het
Gm13084	A	T	4: 143,810,663 (GRCm38)	L366Q	probably damaging	Het
Gm4302	T	A	10: 100,341,727 (GRCm38)	M291K	unknown	Het
Gm8906	C	T	5: 11,505,231 (GRCm38)	P83S	probably damaging	Het
Gnb1l	T	A	16: 18,545,168 (GRCm38)	D154E	probably benign	Het
Igkv10-94	T	C	6: 68,704,743 (GRCm38)	R38G	possibly damaging	Het
Inmt	A	T	6: 55,171,028 (GRCm38)	Y205*	probably null	Het
Krba1	A	G	6: 48,416,299 (GRCm38)	Q1049R	probably benign	Het
Lpxn	T	A	19: 12,833,319 (GRCm38)	C376S	probably damaging	Het
Lrrc52	T	A	1: 167,466,450 (GRCm38)	I89F	probably damaging	Het
Map9	A	T	3: 82,363,458 (GRCm38)	T110S	probably benign	Het
Mccc1	T	C	3: 35,995,818 (GRCm38)	Y75C	probably damaging	Het
Mff	T	A	1: 82,747,091 (GRCm38)	L203*	probably null	Het
Micall1	C	A	15: 79,109,424 (GRCm38)	D47E	unknown	Het
Mink1	T	C	11: 70,603,503 (GRCm38)	F243S	probably damaging	Het
Mlycd	C	T	8: 119,402,477 (GRCm38)	R228W	probably damaging	Het
Msr1	A	T	8: 39,589,424 (GRCm38)	V370E	possibly damaging	Het
Naip6	T	C	13: 100,300,419 (GRCm38)	E532G	probably damaging	Het
Nepn	G	A	10: 52,391,719 (GRCm38)	C27Y	probably damaging	Het
Ninl	T	C	2: 150,955,604 (GRCm38)	H592R	probably benign	Het
Nr4a2	A	G	2: 57,112,249 (GRCm38)	M64T	possibly damaging	Het
Olfr1279	T	A	2: 111,307,020 (GRCm38)	F272I	probably benign	Het
Olfr484	T	C	7: 108,124,574 (GRCm38)	K230E	probably damaging	Het
Oprm1	A	T	10: 6,830,203 (GRCm38)	I171F	possibly damaging	Het
Pcbp1	A	T	6: 86,525,506 (GRCm38)	M137K	possibly damaging	Het
Pcf11	A	T	7: 92,657,316 (GRCm38)	S1215T	probably benign	Het
Pdlim5	A	T	3: 142,311,922 (GRCm38)		probably null	Het
Pecam1	T	C	11: 106,689,031 (GRCm38)	I402V	probably damaging	Het
Pex12	T	C	11: 83,297,642 (GRCm38)	T176A	probably benign	Het
Phf3	T	C	1: 30,831,109 (GRCm38)	K286R	possibly damaging	Het
Pik3ap1	T	A	19: 41,332,321 (GRCm38)	D153V	probably damaging	Het
Pkhd1l1	T	A	15: 44,584,978 (GRCm38)		probably null	Het
Plekhn1	A	G	4: 156,223,335 (GRCm38)	V378A	probably benign	Het
Ptprm	A	T	17: 66,944,288 (GRCm38)	D531E	possibly damaging	Het
Pum2	A	T	12: 8,728,952 (GRCm38)	Q508L	possibly damaging	Het
Rad54l	A	G	4: 116,105,830 (GRCm38)	S324P	probably damaging	Het
Recql5	C	T	11: 115,930,672 (GRCm38)		probably null	Het
Reln	A	T	5: 21,976,596 (GRCm38)	V1763D	possibly damaging	Het
Rp1	T	C	1: 4,348,168 (GRCm38)	N907S	possibly damaging	Het
Scaf11	T	A	15: 96,420,328 (GRCm38)	N452Y	possibly damaging	Het
Scgb2b3	T	A	7: 31,360,214 (GRCm38)	H45L	possibly damaging	Het
Sim1	A	G	10: 50,895,927 (GRCm38)	T11A	probably damaging	Het
Slc5a12	T	A	2: 110,616,714 (GRCm38)	M189K	possibly damaging	Het
Slco2b1	C	T	7: 99,695,063 (GRCm38)	G10S	probably null	Het
Stxbp3	A	G	3: 108,800,755 (GRCm38)	L410P	probably damaging	Het
Sugct	T	C	13: 17,302,009 (GRCm38)	N297D	probably benign	Het
Syne1	A	G	10: 5,233,409 (GRCm38)	I4132T	probably benign	Het
Teddm1b	A	T	1: 153,875,166 (GRCm38)	L240F	probably damaging	Het
Tlr5	C	A	1: 182,975,523 (GRCm38)	D797E	possibly damaging	Het
Tmprss13	G	T	9: 45,338,345 (GRCm38)	G327C	probably damaging	Het
Tnrc18	G	T	5: 142,787,817 (GRCm38)	A419D		Het
Ttc28	T	C	5: 111,280,007 (GRCm38)	Y1790H	probably damaging	Het
Vmn1r125	T	G	7: 21,272,402 (GRCm38)	M75R	probably damaging	Het
Vwa3a	T	A	7: 120,773,030 (GRCm38)	D276E	possibly damaging	Het
Wdfy3	C	T	5: 101,915,437 (GRCm38)	V1322M	probably damaging	Het
Wdr11	T	C	7: 129,628,106 (GRCm38)	S872P	possibly damaging	Het
Zc3h13	T	C	14: 75,321,721 (GRCm38)	S357P	unknown	Het

Other mutations in Dsp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00502:Dsp	APN	13	38,197,846 (GRCm38)	missense	probably damaging	0.99
IGL01337:Dsp	APN	13	38,192,687 (GRCm38)	missense	probably benign	0.44
IGL01371:Dsp	APN	13	38,193,617 (GRCm38)	missense	probably benign	0.13
IGL01473:Dsp	APN	13	38,167,571 (GRCm38)	missense	probably damaging	0.99
IGL01660:Dsp	APN	13	38,176,495 (GRCm38)	missense	possibly damaging	0.90
IGL01723:Dsp	APN	13	38,179,084 (GRCm38)	missense	probably damaging	1.00
IGL01999:Dsp	APN	13	38,181,186 (GRCm38)	missense	probably damaging	0.99
IGL02313:Dsp	APN	13	38,196,523 (GRCm38)	nonsense	probably null
IGL02833:Dsp	APN	13	38,192,921 (GRCm38)	missense	possibly damaging	0.56
IGL03050:Dsp	APN	13	38,188,445 (GRCm38)	splice site	probably benign
IGL03353:Dsp	APN	13	38,186,695 (GRCm38)	missense	probably damaging	1.00
R0052:Dsp	UTSW	13	38,197,364 (GRCm38)	missense	possibly damaging	0.93
R0052:Dsp	UTSW	13	38,197,364 (GRCm38)	missense	possibly damaging	0.93
R0078:Dsp	UTSW	13	38,196,017 (GRCm38)	missense	probably benign	0.22
R0230:Dsp	UTSW	13	38,197,705 (GRCm38)	missense	probably benign	0.03
R0234:Dsp	UTSW	13	38,187,893 (GRCm38)	missense	probably benign	0.13
R0234:Dsp	UTSW	13	38,187,893 (GRCm38)	missense	probably benign	0.13
R0285:Dsp	UTSW	13	38,172,794 (GRCm38)	missense	probably benign
R0326:Dsp	UTSW	13	38,192,870 (GRCm38)	nonsense	probably null
R0332:Dsp	UTSW	13	38,182,228 (GRCm38)	nonsense	probably null
R0471:Dsp	UTSW	13	38,193,350 (GRCm38)	nonsense	probably null
R0567:Dsp	UTSW	13	38,192,438 (GRCm38)	missense	probably benign	0.01
R0611:Dsp	UTSW	13	38,187,741 (GRCm38)	missense	probably damaging	1.00
R0718:Dsp	UTSW	13	38,196,764 (GRCm38)	missense	possibly damaging	0.80
R0926:Dsp	UTSW	13	38,183,218 (GRCm38)	missense	probably damaging	0.97
R1078:Dsp	UTSW	13	38,183,106 (GRCm38)	splice site	probably benign
R1183:Dsp	UTSW	13	38,191,740 (GRCm38)	nonsense	probably null
R1188:Dsp	UTSW	13	38,194,963 (GRCm38)	missense	probably damaging	1.00
R1419:Dsp	UTSW	13	38,186,695 (GRCm38)	missense	probably damaging	1.00
R1445:Dsp	UTSW	13	38,191,931 (GRCm38)	missense	probably damaging	0.98
R1467:Dsp	UTSW	13	38,192,712 (GRCm38)	missense	probably benign	0.00
R1467:Dsp	UTSW	13	38,192,712 (GRCm38)	missense	probably benign	0.00
R1478:Dsp	UTSW	13	38,181,138 (GRCm38)	missense	probably damaging	1.00
R1568:Dsp	UTSW	13	38,175,147 (GRCm38)	missense	probably damaging	1.00
R1572:Dsp	UTSW	13	38,195,738 (GRCm38)	missense	probably damaging	1.00
R1676:Dsp	UTSW	13	38,193,374 (GRCm38)	nonsense	probably null
R1736:Dsp	UTSW	13	38,192,990 (GRCm38)	missense	probably benign	0.01
R1776:Dsp	UTSW	13	38,196,617 (GRCm38)	missense	probably damaging	0.99
R1829:Dsp	UTSW	13	38,193,195 (GRCm38)	missense	probably damaging	1.00
R1878:Dsp	UTSW	13	38,164,855 (GRCm38)	missense	possibly damaging	0.53
R2013:Dsp	UTSW	13	38,191,458 (GRCm38)	missense	probably damaging	1.00
R2161:Dsp	UTSW	13	38,196,451 (GRCm38)	missense	probably damaging	1.00
R2187:Dsp	UTSW	13	38,176,407 (GRCm38)	missense	probably damaging	1.00
R2295:Dsp	UTSW	13	38,197,046 (GRCm38)	missense	probably benign	0.28
R2495:Dsp	UTSW	13	38,193,477 (GRCm38)	missense	possibly damaging	0.91
R2566:Dsp	UTSW	13	38,196,404 (GRCm38)	missense	probably damaging	1.00
R2888:Dsp	UTSW	13	38,192,248 (GRCm38)	missense	possibly damaging	0.92
R3012:Dsp	UTSW	13	38,193,342 (GRCm38)	missense	possibly damaging	0.61
R3614:Dsp	UTSW	13	38,177,199 (GRCm38)	missense	probably damaging	0.98
R3725:Dsp	UTSW	13	38,197,618 (GRCm38)	missense	probably benign	0.00
R3725:Dsp	UTSW	13	38,194,689 (GRCm38)	splice site	probably null
R3797:Dsp	UTSW	13	38,177,284 (GRCm38)	critical splice donor site	probably null
R3841:Dsp	UTSW	13	38,197,705 (GRCm38)	missense	probably benign
R4030:Dsp	UTSW	13	38,191,428 (GRCm38)	missense	possibly damaging	0.84
R4124:Dsp	UTSW	13	38,186,713 (GRCm38)	missense	probably damaging	1.00
R4279:Dsp	UTSW	13	38,185,231 (GRCm38)	missense	probably damaging	1.00
R4334:Dsp	UTSW	13	38,196,664 (GRCm38)	missense	possibly damaging	0.46
R4419:Dsp	UTSW	13	38,195,132 (GRCm38)	missense	probably damaging	1.00
R4615:Dsp	UTSW	13	38,191,632 (GRCm38)	missense	probably damaging	0.98
R4627:Dsp	UTSW	13	38,168,641 (GRCm38)	missense	probably benign	0.01
R4639:Dsp	UTSW	13	38,196,784 (GRCm38)	missense	probably damaging	1.00
R4687:Dsp	UTSW	13	38,191,619 (GRCm38)	missense	probably damaging	1.00
R4735:Dsp	UTSW	13	38,196,040 (GRCm38)	missense	probably damaging	0.99
R4746:Dsp	UTSW	13	38,195,104 (GRCm38)	missense	possibly damaging	0.51
R4772:Dsp	UTSW	13	38,167,528 (GRCm38)	nonsense	probably null
R4830:Dsp	UTSW	13	38,192,864 (GRCm38)	missense	probably benign
R4850:Dsp	UTSW	13	38,192,469 (GRCm38)	missense	probably damaging	1.00
R4959:Dsp	UTSW	13	38,191,710 (GRCm38)	missense	probably benign	0.41
R4963:Dsp	UTSW	13	38,197,870 (GRCm38)	missense	probably damaging	0.99
R4969:Dsp	UTSW	13	38,192,910 (GRCm38)	missense	probably benign	0.00
R4978:Dsp	UTSW	13	38,182,234 (GRCm38)	missense	probably damaging	1.00
R4989:Dsp	UTSW	13	38,197,702 (GRCm38)	missense	possibly damaging	0.93
R5068:Dsp	UTSW	13	38,197,123 (GRCm38)	missense	possibly damaging	0.78
R5069:Dsp	UTSW	13	38,197,123 (GRCm38)	missense	possibly damaging	0.78
R5070:Dsp	UTSW	13	38,197,123 (GRCm38)	missense	possibly damaging	0.78
R5133:Dsp	UTSW	13	38,197,702 (GRCm38)	missense	possibly damaging	0.93
R5138:Dsp	UTSW	13	38,195,845 (GRCm38)	missense	possibly damaging	0.50
R5138:Dsp	UTSW	13	38,183,298 (GRCm38)	missense	probably benign	0.37
R5153:Dsp	UTSW	13	38,182,306 (GRCm38)	missense	probably damaging	1.00
R5199:Dsp	UTSW	13	38,192,902 (GRCm38)	nonsense	probably null
R5226:Dsp	UTSW	13	38,186,770 (GRCm38)	missense	probably damaging	0.99
R5265:Dsp	UTSW	13	38,195,183 (GRCm38)	missense	possibly damaging	0.95
R5371:Dsp	UTSW	13	38,194,889 (GRCm38)	missense	probably damaging	0.97
R5484:Dsp	UTSW	13	38,184,038 (GRCm38)	missense	possibly damaging	0.48
R5534:Dsp	UTSW	13	38,195,842 (GRCm38)	missense	probably benign	0.01
R5569:Dsp	UTSW	13	38,192,652 (GRCm38)	missense	probably benign	0.01
R5854:Dsp	UTSW	13	38,167,501 (GRCm38)	splice site	probably null
R5910:Dsp	UTSW	13	38,192,469 (GRCm38)	missense	possibly damaging	0.95
R5929:Dsp	UTSW	13	38,195,434 (GRCm38)	missense	possibly damaging	0.92
R5940:Dsp	UTSW	13	38,196,026 (GRCm38)	missense	possibly damaging	0.70
R5948:Dsp	UTSW	13	38,195,401 (GRCm38)	missense	possibly damaging	0.95
R5955:Dsp	UTSW	13	38,194,958 (GRCm38)	missense	possibly damaging	0.73
R5970:Dsp	UTSW	13	38,195,702 (GRCm38)	missense	possibly damaging	0.93
R6054:Dsp	UTSW	13	38,167,609 (GRCm38)	missense	probably benign	0.00
R6113:Dsp	UTSW	13	38,192,047 (GRCm38)	missense	probably damaging	1.00
R6139:Dsp	UTSW	13	38,192,406 (GRCm38)	missense	probably damaging	0.97
R6328:Dsp	UTSW	13	38,197,006 (GRCm38)	nonsense	probably null
R6527:Dsp	UTSW	13	38,195,873 (GRCm38)	missense	probably damaging	1.00
R6573:Dsp	UTSW	13	38,196,862 (GRCm38)	missense	probably damaging	1.00
R6628:Dsp	UTSW	13	38,167,622 (GRCm38)	missense	possibly damaging	0.73
R6738:Dsp	UTSW	13	38,192,210 (GRCm38)	missense	possibly damaging	0.87
R6898:Dsp	UTSW	13	38,192,217 (GRCm38)	missense	possibly damaging	0.59
R6919:Dsp	UTSW	13	38,167,655 (GRCm38)	missense	possibly damaging	0.84
R6951:Dsp	UTSW	13	38,167,646 (GRCm38)	missense	possibly damaging	0.95
R7017:Dsp	UTSW	13	38,186,707 (GRCm38)	missense	probably benign	0.02
R7022:Dsp	UTSW	13	38,191,740 (GRCm38)	missense	probably benign	0.06
R7192:Dsp	UTSW	13	38,195,593 (GRCm38)	missense	probably benign	0.09
R7211:Dsp	UTSW	13	38,188,535 (GRCm38)	critical splice donor site	probably null
R7251:Dsp	UTSW	13	38,193,548 (GRCm38)	missense	probably benign	0.02
R7326:Dsp	UTSW	13	38,192,883 (GRCm38)	missense	probably benign	0.01
R7369:Dsp	UTSW	13	38,197,525 (GRCm38)	missense	possibly damaging	0.82
R7376:Dsp	UTSW	13	38,172,843 (GRCm38)	missense	probably damaging	1.00
R7406:Dsp	UTSW	13	38,197,196 (GRCm38)	missense	possibly damaging	0.63
R7439:Dsp	UTSW	13	38,195,449 (GRCm38)	missense	probably benign	0.00
R7439:Dsp	UTSW	13	38,176,502 (GRCm38)	critical splice donor site	probably null
R7441:Dsp	UTSW	13	38,195,449 (GRCm38)	missense	probably benign	0.00
R7477:Dsp	UTSW	13	38,172,863 (GRCm38)	missense	probably damaging	1.00
R7535:Dsp	UTSW	13	38,192,789 (GRCm38)	missense	probably benign	0.05
R7558:Dsp	UTSW	13	38,168,766 (GRCm38)	missense	probably benign	0.02
R7600:Dsp	UTSW	13	38,191,715 (GRCm38)	missense	probably damaging	1.00
R7616:Dsp	UTSW	13	38,191,482 (GRCm38)	missense	probably damaging	0.98
R7702:Dsp	UTSW	13	38,175,207 (GRCm38)	missense	possibly damaging	0.83
R7738:Dsp	UTSW	13	38,185,175 (GRCm38)	missense	probably damaging	0.97
R7815:Dsp	UTSW	13	38,191,470 (GRCm38)	missense	probably benign	0.31
R7882:Dsp	UTSW	13	38,184,018 (GRCm38)	missense	possibly damaging	0.76
R7917:Dsp	UTSW	13	38,167,639 (GRCm38)	nonsense	probably null
R7971:Dsp	UTSW	13	38,192,523 (GRCm38)	missense	probably damaging	0.97
R8104:Dsp	UTSW	13	38,168,624 (GRCm38)	missense	probably benign	0.03
R8176:Dsp	UTSW	13	38,192,810 (GRCm38)	missense	possibly damaging	0.56
R8303:Dsp	UTSW	13	38,197,343 (GRCm38)	missense	probably benign
R8323:Dsp	UTSW	13	38,172,830 (GRCm38)	missense	possibly damaging	0.80
R8326:Dsp	UTSW	13	38,191,635 (GRCm38)	missense	probably damaging	1.00
R8358:Dsp	UTSW	13	38,192,481 (GRCm38)	missense	possibly damaging	0.92
R8410:Dsp	UTSW	13	38,196,815 (GRCm38)	missense	possibly damaging	0.94
R8552:Dsp	UTSW	13	38,185,141 (GRCm38)	missense	probably damaging	0.98
R8713:Dsp	UTSW	13	38,168,725 (GRCm38)	missense	probably damaging	0.99
R8801:Dsp	UTSW	13	38,197,526 (GRCm38)	missense	possibly damaging	0.81
R8900:Dsp	UTSW	13	38,181,179 (GRCm38)	missense	probably damaging	0.99
R8901:Dsp	UTSW	13	38,181,179 (GRCm38)	missense	probably damaging	0.99
R8968:Dsp	UTSW	13	38,151,620 (GRCm38)	missense	possibly damaging	0.83
R9014:Dsp	UTSW	13	38,192,724 (GRCm38)	missense	possibly damaging	0.83
R9021:Dsp	UTSW	13	38,196,832 (GRCm38)	missense	possibly damaging	0.61
R9030:Dsp	UTSW	13	38,168,697 (GRCm38)	missense	probably damaging	1.00
R9124:Dsp	UTSW	13	38,193,300 (GRCm38)	missense	probably benign	0.42
R9129:Dsp	UTSW	13	38,193,150 (GRCm38)	missense	probably benign	0.09
R9143:Dsp	UTSW	13	38,193,361 (GRCm38)	missense	probably benign	0.05
R9450:Dsp	UTSW	13	38,192,403 (GRCm38)	missense	probably damaging	1.00
R9488:Dsp	UTSW	13	38,193,242 (GRCm38)	missense	probably benign	0.04
R9514:Dsp	UTSW	13	38,187,805 (GRCm38)	missense	probably benign	0.02
R9789:Dsp	UTSW	13	38,183,961 (GRCm38)	missense	probably benign	0.03
R9792:Dsp	UTSW	13	38,195,518 (GRCm38)	missense	possibly damaging	0.87
X0023:Dsp	UTSW	13	38,197,684 (GRCm38)	missense	probably benign	0.00
X0024:Dsp	UTSW	13	38,193,255 (GRCm38)	missense	probably benign	0.04
X0027:Dsp	UTSW	13	38,186,646 (GRCm38)	missense	possibly damaging	0.68
X0067:Dsp	UTSW	13	38,182,312 (GRCm38)	missense	possibly damaging	0.85
Z1176:Dsp	UTSW	13	38,197,190 (GRCm38)	missense	possibly damaging	0.81
Z1177:Dsp	UTSW	13	38,192,854 (GRCm38)	frame shift	probably null
Z1177:Dsp	UTSW	13	38,151,689 (GRCm38)	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AATTCAAACTGCTCACTGTGGG -3'
(R):5'- TTGCCCTCTTGATTGGCAG -3'

Sequencing Primer
(F):5'- GAGGCTATGTCACCTCATGATG -3'
(R):5'- CCCTCTTGATTGGCAGAAGCTTATG -3'

Posted On

2019-05-15