Incidental Mutation 'R7135:Dsp'
ID553025
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Namedesmoplakin
Synonyms5730453H04Rik, DP, 2300002E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7135 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location38151294-38198577 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 38179073 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 443 (Y443F)
Ref Sequence ENSEMBL: ENSMUSP00000115062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
Predicted Effect probably damaging
Transcript: ENSMUST00000124830
AA Change: Y443F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: Y443F

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127906
AA Change: Y443F

PolyPhen 2 Score 0.419 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: Y443F

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700016G14Rik T C 13: 24,741,506 S78P probably benign Het
Aars2 T A 17: 45,508,961 Y221* probably null Het
AC166344.1 T A 14: 43,300,788 F97I Het
Ankmy2 T C 12: 36,196,312 S412P probably benign Het
Ap1s3 T C 1: 79,609,202 T144A probably benign Het
Asb3 T A 11: 30,998,501 L59* probably null Het
Asxl3 G T 18: 22,517,701 G916* probably null Het
Asxl3 G C 18: 22,517,702 G916A probably damaging Het
Birc2 A C 9: 7,818,761 F610V probably damaging Het
Camk4 G A 18: 33,107,943 probably null Het
Ccdc162 A G 10: 41,673,859 S343P probably benign Het
Ccnk T A 12: 108,186,475 L17Q probably damaging Het
Cd59b G A 2: 104,084,447 W63* probably null Het
Chrm3 C T 13: 9,877,801 V400I probably benign Het
Crb1 C A 1: 139,243,367 V762F probably damaging Het
Cspp1 C T 1: 10,088,936 T529I possibly damaging Het
Cttnbp2 A G 6: 18,448,447 I71T possibly damaging Het
Cyb561 C A 11: 105,935,567 G90V probably damaging Het
Cyld T A 8: 88,744,892 D804E possibly damaging Het
Ddx31 G A 2: 28,848,306 V160I probably benign Het
Dgkg T C 16: 22,500,382 D643G probably damaging Het
Dnah12 G A 14: 26,778,912 probably null Het
Dnah12 T G 14: 26,801,413 I1953S probably damaging Het
Dnah7b T C 1: 46,139,710 W848R probably damaging Het
Dnah7c C T 1: 46,533,208 T947M probably damaging Het
Dnmt3c C A 2: 153,714,952 probably null Het
Espl1 T A 15: 102,319,524 C1603* probably null Het
Faiml G T 9: 99,234,443 R65S probably benign Het
Gfpt2 T C 11: 49,804,955 I4T probably damaging Het
Gm10376 T A 14: 43,010,493 M179L probably benign Het
Gm13084 A T 4: 143,810,663 L366Q probably damaging Het
Gm4302 T A 10: 100,341,727 M291K unknown Het
Gm8906 C T 5: 11,505,231 P83S probably damaging Het
Gnb1l T A 16: 18,545,168 D154E probably benign Het
Igkv10-94 T C 6: 68,704,743 R38G possibly damaging Het
Inmt A T 6: 55,171,028 Y205* probably null Het
Krba1 A G 6: 48,416,299 Q1049R probably benign Het
Lpxn T A 19: 12,833,319 C376S probably damaging Het
Lrrc52 T A 1: 167,466,450 I89F probably damaging Het
Map9 A T 3: 82,363,458 T110S probably benign Het
Mccc1 T C 3: 35,995,818 Y75C probably damaging Het
Mff T A 1: 82,747,091 L203* probably null Het
Micall1 C A 15: 79,109,424 D47E unknown Het
Mink1 T C 11: 70,603,503 F243S probably damaging Het
Mlycd C T 8: 119,402,477 R228W probably damaging Het
Msr1 A T 8: 39,589,424 V370E possibly damaging Het
Naip6 T C 13: 100,300,419 E532G probably damaging Het
Nepn G A 10: 52,391,719 C27Y probably damaging Het
Ninl T C 2: 150,955,604 H592R probably benign Het
Nr4a2 A G 2: 57,112,249 M64T possibly damaging Het
Olfr1279 T A 2: 111,307,020 F272I probably benign Het
Olfr484 T C 7: 108,124,574 K230E probably damaging Het
Oprm1 A T 10: 6,830,203 I171F possibly damaging Het
Pcbp1 A T 6: 86,525,506 M137K possibly damaging Het
Pcf11 A T 7: 92,657,316 S1215T probably benign Het
Pdlim5 A T 3: 142,311,922 probably null Het
Pecam1 T C 11: 106,689,031 I402V probably damaging Het
Pex12 T C 11: 83,297,642 T176A probably benign Het
Phf3 T C 1: 30,831,109 K286R possibly damaging Het
Pik3ap1 T A 19: 41,332,321 D153V probably damaging Het
Pkhd1l1 T A 15: 44,584,978 probably null Het
Plekhn1 A G 4: 156,223,335 V378A probably benign Het
Ptprm A T 17: 66,944,288 D531E possibly damaging Het
Pum2 A T 12: 8,728,952 Q508L possibly damaging Het
Rad54l A G 4: 116,105,830 S324P probably damaging Het
Recql5 C T 11: 115,930,672 probably null Het
Reln A T 5: 21,976,596 V1763D possibly damaging Het
Rp1 T C 1: 4,348,168 N907S possibly damaging Het
Scaf11 T A 15: 96,420,328 N452Y possibly damaging Het
Scgb2b3 T A 7: 31,360,214 H45L possibly damaging Het
Sim1 A G 10: 50,895,927 T11A probably damaging Het
Slc5a12 T A 2: 110,616,714 M189K possibly damaging Het
Slco2b1 C T 7: 99,695,063 G10S probably null Het
Stxbp3 A G 3: 108,800,755 L410P probably damaging Het
Sugct T C 13: 17,302,009 N297D probably benign Het
Syne1 A G 10: 5,233,409 I4132T probably benign Het
Teddm1b A T 1: 153,875,166 L240F probably damaging Het
Tlr5 C A 1: 182,975,523 D797E possibly damaging Het
Tmprss13 G T 9: 45,338,345 G327C probably damaging Het
Tnrc18 G T 5: 142,787,817 A419D Het
Ttc28 T C 5: 111,280,007 Y1790H probably damaging Het
Vmn1r125 T G 7: 21,272,402 M75R probably damaging Het
Vwa3a T A 7: 120,773,030 D276E possibly damaging Het
Wdfy3 C T 5: 101,915,437 V1322M probably damaging Het
Wdr11 T C 7: 129,628,106 S872P possibly damaging Het
Zc3h13 T C 14: 75,321,721 S357P unknown Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38197846 missense probably damaging 0.99
IGL01337:Dsp APN 13 38192687 missense probably benign 0.44
IGL01371:Dsp APN 13 38193617 missense probably benign 0.13
IGL01473:Dsp APN 13 38167571 missense probably damaging 0.99
IGL01660:Dsp APN 13 38176495 missense possibly damaging 0.90
IGL01723:Dsp APN 13 38179084 missense probably damaging 1.00
IGL01999:Dsp APN 13 38181186 missense probably damaging 0.99
IGL02313:Dsp APN 13 38196523 nonsense probably null
IGL02833:Dsp APN 13 38192921 missense possibly damaging 0.56
IGL03050:Dsp APN 13 38188445 splice site probably benign
IGL03353:Dsp APN 13 38186695 missense probably damaging 1.00
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0052:Dsp UTSW 13 38197364 missense possibly damaging 0.93
R0078:Dsp UTSW 13 38196017 missense probably benign 0.22
R0230:Dsp UTSW 13 38197705 missense probably benign 0.03
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0234:Dsp UTSW 13 38187893 missense probably benign 0.13
R0285:Dsp UTSW 13 38172794 missense probably benign
R0326:Dsp UTSW 13 38192870 nonsense probably null
R0332:Dsp UTSW 13 38182228 nonsense probably null
R0471:Dsp UTSW 13 38193350 nonsense probably null
R0567:Dsp UTSW 13 38192438 missense probably benign 0.01
R0611:Dsp UTSW 13 38187741 missense probably damaging 1.00
R0718:Dsp UTSW 13 38196764 missense possibly damaging 0.80
R0926:Dsp UTSW 13 38183218 missense probably damaging 0.97
R1078:Dsp UTSW 13 38183106 splice site probably benign
R1183:Dsp UTSW 13 38191740 nonsense probably null
R1188:Dsp UTSW 13 38194963 missense probably damaging 1.00
R1419:Dsp UTSW 13 38186695 missense probably damaging 1.00
R1445:Dsp UTSW 13 38191931 missense probably damaging 0.98
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1467:Dsp UTSW 13 38192712 missense probably benign 0.00
R1478:Dsp UTSW 13 38181138 missense probably damaging 1.00
R1568:Dsp UTSW 13 38175147 missense probably damaging 1.00
R1572:Dsp UTSW 13 38195738 missense probably damaging 1.00
R1676:Dsp UTSW 13 38193374 nonsense probably null
R1736:Dsp UTSW 13 38192990 missense probably benign 0.01
R1776:Dsp UTSW 13 38196617 missense probably damaging 0.99
R1829:Dsp UTSW 13 38193195 missense probably damaging 1.00
R1878:Dsp UTSW 13 38164855 missense possibly damaging 0.53
R2013:Dsp UTSW 13 38191458 missense probably damaging 1.00
R2161:Dsp UTSW 13 38196451 missense probably damaging 1.00
R2187:Dsp UTSW 13 38176407 missense probably damaging 1.00
R2295:Dsp UTSW 13 38197046 missense probably benign 0.28
R2495:Dsp UTSW 13 38193477 missense possibly damaging 0.91
R2566:Dsp UTSW 13 38196404 missense probably damaging 1.00
R2888:Dsp UTSW 13 38192248 missense possibly damaging 0.92
R3012:Dsp UTSW 13 38193342 missense possibly damaging 0.61
R3614:Dsp UTSW 13 38177199 missense probably damaging 0.98
R3725:Dsp UTSW 13 38194689 splice site probably null
R3725:Dsp UTSW 13 38197618 missense probably benign 0.00
R3797:Dsp UTSW 13 38177284 critical splice donor site probably null
R3841:Dsp UTSW 13 38197705 missense probably benign
R4030:Dsp UTSW 13 38191428 missense possibly damaging 0.84
R4124:Dsp UTSW 13 38186713 missense probably damaging 1.00
R4279:Dsp UTSW 13 38185231 missense probably damaging 1.00
R4334:Dsp UTSW 13 38196664 missense possibly damaging 0.46
R4419:Dsp UTSW 13 38195132 missense probably damaging 1.00
R4615:Dsp UTSW 13 38191632 missense probably damaging 0.98
R4627:Dsp UTSW 13 38168641 missense probably benign 0.01
R4639:Dsp UTSW 13 38196784 missense probably damaging 1.00
R4687:Dsp UTSW 13 38191619 missense probably damaging 1.00
R4735:Dsp UTSW 13 38196040 missense probably damaging 0.99
R4746:Dsp UTSW 13 38195104 missense possibly damaging 0.51
R4772:Dsp UTSW 13 38167528 nonsense probably null
R4830:Dsp UTSW 13 38192864 missense probably benign
R4850:Dsp UTSW 13 38192469 missense probably damaging 1.00
R4959:Dsp UTSW 13 38191710 missense probably benign 0.41
R4963:Dsp UTSW 13 38197870 missense probably damaging 0.99
R4969:Dsp UTSW 13 38192910 missense probably benign 0.00
R4978:Dsp UTSW 13 38182234 missense probably damaging 1.00
R4989:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5068:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5069:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5070:Dsp UTSW 13 38197123 missense possibly damaging 0.78
R5133:Dsp UTSW 13 38197702 missense possibly damaging 0.93
R5138:Dsp UTSW 13 38183298 missense probably benign 0.37
R5138:Dsp UTSW 13 38195845 missense possibly damaging 0.50
R5153:Dsp UTSW 13 38182306 missense probably damaging 1.00
R5199:Dsp UTSW 13 38192902 nonsense probably null
R5226:Dsp UTSW 13 38186770 missense probably damaging 0.99
R5265:Dsp UTSW 13 38195183 missense possibly damaging 0.95
R5371:Dsp UTSW 13 38194889 missense probably damaging 0.97
R5484:Dsp UTSW 13 38184038 missense possibly damaging 0.48
R5534:Dsp UTSW 13 38195842 missense probably benign 0.01
R5569:Dsp UTSW 13 38192652 missense probably benign 0.01
R5854:Dsp UTSW 13 38167501 splice site probably null
R5910:Dsp UTSW 13 38192469 missense possibly damaging 0.95
R5929:Dsp UTSW 13 38195434 missense possibly damaging 0.92
R5940:Dsp UTSW 13 38196026 missense possibly damaging 0.70
R5948:Dsp UTSW 13 38195401 missense possibly damaging 0.95
R5955:Dsp UTSW 13 38194958 missense possibly damaging 0.73
R5970:Dsp UTSW 13 38195702 missense possibly damaging 0.93
R6054:Dsp UTSW 13 38167609 missense probably benign 0.00
R6113:Dsp UTSW 13 38192047 missense probably damaging 1.00
R6139:Dsp UTSW 13 38192406 missense probably damaging 0.97
R6328:Dsp UTSW 13 38197006 nonsense probably null
R6527:Dsp UTSW 13 38195873 missense probably damaging 1.00
R6573:Dsp UTSW 13 38196862 missense probably damaging 1.00
R6628:Dsp UTSW 13 38167622 missense possibly damaging 0.73
R6738:Dsp UTSW 13 38192210 missense possibly damaging 0.87
R6898:Dsp UTSW 13 38192217 missense possibly damaging 0.59
R6919:Dsp UTSW 13 38167655 missense possibly damaging 0.84
R6951:Dsp UTSW 13 38167646 missense possibly damaging 0.95
R7017:Dsp UTSW 13 38186707 missense probably benign 0.02
R7022:Dsp UTSW 13 38191740 missense probably benign 0.06
R7192:Dsp UTSW 13 38195593 missense probably benign 0.09
R7211:Dsp UTSW 13 38188535 critical splice donor site probably null
R7251:Dsp UTSW 13 38193548 missense probably benign 0.02
R7326:Dsp UTSW 13 38192883 missense probably benign 0.01
R7369:Dsp UTSW 13 38197525 missense possibly damaging 0.82
R7376:Dsp UTSW 13 38172843 missense probably damaging 1.00
R7406:Dsp UTSW 13 38197196 missense possibly damaging 0.63
R7439:Dsp UTSW 13 38176502 critical splice donor site probably null
R7439:Dsp UTSW 13 38195449 missense probably benign 0.00
R7441:Dsp UTSW 13 38195449 missense probably benign 0.00
R7477:Dsp UTSW 13 38172863 missense probably damaging 1.00
R7535:Dsp UTSW 13 38192789 missense probably benign 0.05
R7558:Dsp UTSW 13 38168766 missense probably benign 0.02
R7600:Dsp UTSW 13 38191715 missense probably damaging 1.00
R7616:Dsp UTSW 13 38191482 missense probably damaging 0.98
R7702:Dsp UTSW 13 38175207 missense possibly damaging 0.83
R7738:Dsp UTSW 13 38185175 missense probably damaging 0.97
R7815:Dsp UTSW 13 38191470 missense probably benign 0.31
X0023:Dsp UTSW 13 38197684 missense probably benign 0.00
X0024:Dsp UTSW 13 38193255 missense probably benign 0.04
X0027:Dsp UTSW 13 38186646 missense possibly damaging 0.68
X0067:Dsp UTSW 13 38182312 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- AATTCAAACTGCTCACTGTGGG -3'
(R):5'- TTGCCCTCTTGATTGGCAG -3'

Sequencing Primer
(F):5'- GAGGCTATGTCACCTCATGATG -3'
(R):5'- CCCTCTTGATTGGCAGAAGCTTATG -3'
Posted On2019-05-15