Incidental Mutation 'R0600:Otog'
ID55303
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Nameotogelin
SynonymsOtgn
MMRRC Submission 038789-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R0600 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location46240987-46311434 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 46251395 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
Predicted Effect probably benign
Transcript: ENSMUST00000164538
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210281
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,357,660 S150P probably damaging Het
4932431P20Rik T A 7: 29,533,265 noncoding transcript Het
5530400C23Rik T G 6: 133,293,211 probably benign Het
Ahctf1 A C 1: 179,763,468 probably null Het
Ang5 T C 14: 43,962,749 V90A probably benign Het
Ano9 C T 7: 141,104,710 G442R probably damaging Het
Apaf1 G A 10: 91,060,052 T386I probably damaging Het
Apob C A 12: 8,006,440 H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 probably benign Het
Asxl1 T A 2: 153,399,904 D791E probably benign Het
Avl9 T C 6: 56,736,906 V383A probably benign Het
Btbd1 A C 7: 81,816,006 D197E probably damaging Het
C87499 A T 4: 88,629,299 I45K probably damaging Het
Camta2 T C 11: 70,673,959 I938V possibly damaging Het
Cdca7 C A 2: 72,483,467 A200D possibly damaging Het
Cep104 A T 4: 154,006,792 Y923F possibly damaging Het
Cep135 G C 5: 76,621,305 V601L probably benign Het
Ces2b G A 8: 104,835,910 G291S probably benign Het
Col6a6 C T 9: 105,761,440 G1400D probably damaging Het
Cyth2 T C 7: 45,813,117 E1G probably damaging Het
Dand5 A T 8: 84,816,292 L185Q probably damaging Het
Dck T C 5: 88,781,221 V253A probably benign Het
Ddx20 A G 3: 105,679,080 S650P probably damaging Het
Dicer1 G A 12: 104,706,864 P799S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eya2 G A 2: 165,769,237 C477Y probably damaging Het
Fam208b A T 13: 3,576,054 F1299I probably benign Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Galntl6 T C 8: 57,837,183 probably null Het
Gda A T 19: 21,434,303 F44I possibly damaging Het
Gli2 G A 1: 118,840,389 R703C probably damaging Het
Gm14085 A T 2: 122,514,398 I162F probably damaging Het
Golgb1 T A 16: 36,916,271 L1960Q probably damaging Het
Gramd1b T C 9: 40,308,355 D341G probably damaging Het
Grid2 G T 6: 63,503,435 A78S probably benign Het
Hao2 A T 3: 98,883,560 probably benign Het
Hook3 A G 8: 26,118,986 V10A probably benign Het
Kif20a A G 18: 34,629,209 E425G probably damaging Het
Lrp1 T C 10: 127,567,383 D2107G probably benign Het
Lrriq3 T C 3: 155,187,736 I358T possibly damaging Het
Mad2l2 A G 4: 148,140,924 D17G possibly damaging Het
Mastl G T 2: 23,133,346 T455K probably benign Het
Mkln1 G T 6: 31,432,927 probably benign Het
Mmp1b A T 9: 7,387,947 Y16N possibly damaging Het
Mmp24 C T 2: 155,792,597 A79V probably benign Het
Mrps35 T A 6: 147,070,734 C292S possibly damaging Het
Myom1 T C 17: 71,120,648 F1435L possibly damaging Het
Nars2 C T 7: 97,039,923 H351Y probably damaging Het
Nat2 A T 8: 67,501,267 I10F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm5 A T 7: 104,153,869 Y462* probably null Het
Olfr1228 C A 2: 89,249,398 E87* probably null Het
Olfr1339 C T 4: 118,734,789 H87Y probably damaging Het
Olfr1508 T C 14: 52,463,509 I167V probably benign Het
Olfr322 C A 11: 58,666,160 F200L probably damaging Het
Olfr340 C A 2: 36,452,648 A21E probably benign Het
Olfr44 A T 9: 39,484,988 F85L probably benign Het
Olfr495 T A 7: 108,395,231 I37N probably damaging Het
Olfr855 T C 9: 19,585,304 S256P possibly damaging Het
Olfr926 T A 9: 38,877,815 I213N probably damaging Het
Pdcd2l A T 7: 34,192,807 D212E possibly damaging Het
Pex5 T C 6: 124,404,637 N213S probably benign Het
Pkn3 C T 2: 30,081,134 P238S probably benign Het
Prl2b1 A T 13: 27,390,740 probably null Het
Ptprb A T 10: 116,368,807 I1849L possibly damaging Het
Rasal3 G T 17: 32,393,526 S787Y probably damaging Het
Scn2a T A 2: 65,701,833 D596E possibly damaging Het
Sdhd A T 9: 50,603,764 V9D possibly damaging Het
Serinc5 T C 13: 92,708,057 S436P probably damaging Het
Slc27a1 C T 8: 71,584,164 P348L probably damaging Het
Smg1 G A 7: 118,160,383 probably benign Het
Sorl1 A T 9: 42,043,900 probably benign Het
Sprtn T A 8: 124,900,218 H112Q probably damaging Het
Tet2 A G 3: 133,467,602 M1633T probably benign Het
Tet2 T A 3: 133,467,725 D1592V probably benign Het
Tmem68 A T 4: 3,569,667 C8S probably damaging Het
Tnrc6a T A 7: 123,171,816 I943N probably benign Het
Trib2 A T 12: 15,794,068 V191D probably damaging Het
Tsc22d4 T C 5: 137,762,655 S113P probably damaging Het
Ttc21b T C 2: 66,239,570 R250G probably damaging Het
Ubr2 T C 17: 46,967,248 Y721C probably damaging Het
Ubtfl1 A T 9: 18,409,364 I63F probably damaging Het
Ush1c G A 7: 46,224,908 P171S probably benign Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vangl1 A G 3: 102,166,937 Y285H probably damaging Het
Virma A G 4: 11,498,769 D70G probably damaging Het
Vmn2r102 T C 17: 19,678,015 F431L probably benign Het
Wdr17 A G 8: 54,661,495 I662T probably damaging Het
Wisp2 G A 2: 163,825,313 C78Y probably damaging Het
Zfp160 G A 17: 21,027,006 R606H probably benign Het
Zfp369 C T 13: 65,296,434 R464C probably damaging Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 46251282 missense probably damaging 1.00
IGL00725:Otog APN 7 46274092 missense probably damaging 1.00
IGL00757:Otog APN 7 46290128 missense probably damaging 1.00
IGL00822:Otog APN 7 46295880 missense probably benign 0.24
IGL01354:Otog APN 7 46289726 missense probably damaging 1.00
IGL01567:Otog APN 7 46276615 splice site probably benign
IGL02034:Otog APN 7 46295993 nonsense probably null
IGL02090:Otog APN 7 46300147 missense probably damaging 1.00
IGL02132:Otog APN 7 46305479 missense probably damaging 0.99
IGL02148:Otog APN 7 46300587 missense probably damaging 1.00
IGL02173:Otog APN 7 46276741 splice site probably benign
IGL02199:Otog APN 7 46277351 missense possibly damaging 0.90
IGL02216:Otog APN 7 46301468 missense probably damaging 1.00
IGL02322:Otog APN 7 46301457 missense probably benign 0.01
IGL02330:Otog APN 7 46288069 missense possibly damaging 0.84
IGL02529:Otog APN 7 46259957 missense probably damaging 0.99
IGL02898:Otog APN 7 46310138 missense probably damaging 1.00
IGL02970:Otog APN 7 46295867 missense probably benign 0.11
IGL03085:Otog APN 7 46305922 critical splice donor site probably null
IGL03108:Otog APN 7 46251338 missense probably damaging 1.00
IGL03275:Otog APN 7 46306230 missense probably damaging 1.00
I1329:Otog UTSW 7 46246503 missense probably benign 0.02
IGL02984:Otog UTSW 7 46305508 missense probably damaging 0.98
PIT4472001:Otog UTSW 7 46295849 missense probably damaging 1.00
R0032:Otog UTSW 7 46288213 nonsense probably null
R0032:Otog UTSW 7 46304231 missense probably damaging 0.97
R0105:Otog UTSW 7 46288366 missense possibly damaging 0.79
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0164:Otog UTSW 7 46304231 missense probably damaging 0.97
R0165:Otog UTSW 7 46304231 missense probably damaging 0.97
R0166:Otog UTSW 7 46304231 missense probably damaging 0.97
R0167:Otog UTSW 7 46304231 missense probably damaging 0.97
R0240:Otog UTSW 7 46264032 splice site probably null
R0240:Otog UTSW 7 46264032 splice site probably null
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0242:Otog UTSW 7 46267381 missense probably damaging 0.98
R0282:Otog UTSW 7 46277493 missense possibly damaging 0.93
R0392:Otog UTSW 7 46250075 missense probably benign 0.00
R0436:Otog UTSW 7 46265936 splice site probably benign
R0441:Otog UTSW 7 46305877 missense probably damaging 1.00
R0499:Otog UTSW 7 46273832 missense probably damaging 1.00
R0530:Otog UTSW 7 46298244 missense probably damaging 0.98
R0541:Otog UTSW 7 46269249 splice site probably benign
R0626:Otog UTSW 7 46271373 missense possibly damaging 0.95
R0636:Otog UTSW 7 46264228 critical splice donor site probably null
R0764:Otog UTSW 7 46300494 missense probably benign 0.00
R0833:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0836:Otog UTSW 7 46269362 missense possibly damaging 0.94
R0844:Otog UTSW 7 46287828 missense possibly damaging 0.53
R1029:Otog UTSW 7 46274595 missense probably damaging 1.00
R1116:Otog UTSW 7 46300601 splice site probably benign
R1134:Otog UTSW 7 46298514 missense probably damaging 1.00
R1183:Otog UTSW 7 46289755 missense probably benign 0.41
R1204:Otog UTSW 7 46259911 missense probably benign 0.16
R1301:Otog UTSW 7 46289689 missense probably damaging 1.00
R1344:Otog UTSW 7 46274615 missense probably damaging 1.00
R1384:Otog UTSW 7 46273695 splice site probably benign
R1418:Otog UTSW 7 46274615 missense probably damaging 1.00
R1432:Otog UTSW 7 46300583 missense probably damaging 1.00
R1479:Otog UTSW 7 46295978 missense possibly damaging 0.75
R1521:Otog UTSW 7 46259264 missense possibly damaging 0.71
R1589:Otog UTSW 7 46283908 missense probably benign 0.18
R1671:Otog UTSW 7 46261786 missense probably damaging 1.00
R1773:Otog UTSW 7 46288159 missense probably benign 0.28
R1806:Otog UTSW 7 46290937 critical splice acceptor site probably null
R1843:Otog UTSW 7 46246283 missense probably damaging 1.00
R1873:Otog UTSW 7 46269343 missense probably damaging 1.00
R1923:Otog UTSW 7 46246283 missense probably damaging 1.00
R1927:Otog UTSW 7 46246283 missense probably damaging 1.00
R2008:Otog UTSW 7 46264074 missense probably benign 0.43
R2048:Otog UTSW 7 46287639 missense probably damaging 1.00
R2131:Otog UTSW 7 46250100 missense probably damaging 1.00
R2153:Otog UTSW 7 46302904 missense probably damaging 1.00
R2240:Otog UTSW 7 46241029 start codon destroyed probably null
R2278:Otog UTSW 7 46300044 missense probably damaging 1.00
R2407:Otog UTSW 7 46241540 missense probably benign 0.10
R2424:Otog UTSW 7 46298169 nonsense probably null
R2513:Otog UTSW 7 46305590 critical splice donor site probably null
R2863:Otog UTSW 7 46269306 missense probably damaging 1.00
R3148:Otog UTSW 7 46290169 missense probably damaging 1.00
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3732:Otog UTSW 7 46288368 missense probably benign 0.03
R3733:Otog UTSW 7 46288368 missense probably benign 0.03
R3734:Otog UTSW 7 46288368 missense probably benign 0.03
R3855:Otog UTSW 7 46273760 missense possibly damaging 0.65
R3880:Otog UTSW 7 46288021 missense possibly damaging 0.93
R4081:Otog UTSW 7 46288299 missense possibly damaging 0.92
R4349:Otog UTSW 7 46274189 missense probably damaging 0.99
R4382:Otog UTSW 7 46289698 missense probably damaging 1.00
R4392:Otog UTSW 7 46285124 missense probably damaging 0.98
R4520:Otog UTSW 7 46241053 unclassified probably benign
R4569:Otog UTSW 7 46310147 missense probably damaging 1.00
R4580:Otog UTSW 7 46287801 missense possibly damaging 0.78
R4672:Otog UTSW 7 46289786 missense probably damaging 0.98
R4764:Otog UTSW 7 46288519 missense probably benign 0.29
R4910:Otog UTSW 7 46264062 missense probably damaging 1.00
R4910:Otog UTSW 7 46298534 missense probably damaging 1.00
R4913:Otog UTSW 7 46264102 missense probably benign 0.31
R4975:Otog UTSW 7 46287991 missense probably benign 0.00
R4996:Otog UTSW 7 46298606 missense possibly damaging 0.51
R4996:Otog UTSW 7 46305510 nonsense probably null
R5116:Otog UTSW 7 46273767 missense probably benign 0.34
R5138:Otog UTSW 7 46250006 missense possibly damaging 0.61
R5169:Otog UTSW 7 46298148 missense probably benign 0.06
R5239:Otog UTSW 7 46287435 missense probably benign 0.15
R5277:Otog UTSW 7 46246621 missense possibly damaging 0.89
R5287:Otog UTSW 7 46269329 missense probably damaging 0.98
R5299:Otog UTSW 7 46288851 missense probably benign 0.16
R5378:Otog UTSW 7 46255004 missense probably damaging 1.00
R5382:Otog UTSW 7 46249004 missense probably damaging 1.00
R5487:Otog UTSW 7 46288768 missense probably benign 0.27
R5507:Otog UTSW 7 46261699 missense probably damaging 1.00
R5517:Otog UTSW 7 46274571 missense probably damaging 1.00
R5643:Otog UTSW 7 46287447 missense probably damaging 1.00
R5757:Otog UTSW 7 46241121 critical splice donor site probably null
R5910:Otog UTSW 7 46298598 missense possibly damaging 0.94
R6019:Otog UTSW 7 46288950 missense probably benign 0.00
R6150:Otog UTSW 7 46264059 missense possibly damaging 0.82
R6225:Otog UTSW 7 46249034 missense possibly damaging 0.67
R6271:Otog UTSW 7 46252040 missense probably damaging 1.00
R6317:Otog UTSW 7 46301215 missense probably damaging 1.00
R6454:Otog UTSW 7 46305817 missense probably damaging 1.00
R6640:Otog UTSW 7 46261743 missense possibly damaging 0.92
R6753:Otog UTSW 7 46249071 missense probably benign 0.06
R6788:Otog UTSW 7 46298317 missense probably damaging 1.00
R6859:Otog UTSW 7 46273781 missense probably damaging 0.96
R7033:Otog UTSW 7 46267398 critical splice donor site probably null
R7071:Otog UTSW 7 46267323 missense probably damaging 1.00
R7084:Otog UTSW 7 46298566 nonsense probably null
R7116:Otog UTSW 7 46298265 missense probably damaging 0.99
R7202:Otog UTSW 7 46288050 missense probably damaging 0.97
R7365:Otog UTSW 7 46298308 missense probably damaging 1.00
R7468:Otog UTSW 7 46264119 missense probably benign
R7475:Otog UTSW 7 46267276 missense probably damaging 0.99
R7502:Otog UTSW 7 46298615 missense probably damaging 1.00
R7558:Otog UTSW 7 46303160 missense probably damaging 0.99
R7577:Otog UTSW 7 46287855 missense possibly damaging 0.62
R7651:Otog UTSW 7 46241761 missense probably benign 0.00
R7689:Otog UTSW 7 46252056 missense probably damaging 1.00
X0062:Otog UTSW 7 46259921 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTGAATCAGAGCCTGCTGTCC -3'
(R):5'- TCTCAGAATGTCAGAGCACCCTCC -3'

Sequencing Primer
(F):5'- GCCTGCTGTCCTCCCAG -3'
(R):5'- gccaaattgctgtgtgacc -3'
Posted On2013-07-11