Mutagenetix > Incidental Mutation

Incidental Mutation 'R7135:Espl1'

553034

Institutional Source

Beutler Lab

Gene Symbol

Espl1

Ensembl Gene

ENSMUSG00000058290

Gene Name

extra spindle pole bodies 1, separase

Synonyms

SSE, ESP1, PRCE, Cerp, PRCE, separase

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7135 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102296266-102324357 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 102319524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Stop codon at position 1603 (C1603*)

Ref Sequence

ENSEMBL: ENSMUSP00000064465 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]

AlphaFold

P60330

Predicted Effect

probably null
Transcript: ENSMUST00000064924
AA Change: C1603*

SMART Domains

Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: C1603*

Domain	Start	End	E-Value	Type
low complexity region	236	245	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	785	794	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
low complexity region	1312	1317	N/A	INTRINSIC
low complexity region	1565	1579	N/A	INTRINSIC
low complexity region	1625	1636	N/A	INTRINSIC
Pfam:Peptidase_C50	1716	2065	4.2e-93	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000229050
AA Change: C1603*

Predicted Effect

probably benign
Transcript: ENSMUST00000229942

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

100% (83/83)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 86 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700016G14Rik	T	C	13: 24,741,506	S78P	probably benign	Het
Aars2	T	A	17: 45,508,961	Y221*	probably null	Het
AC166344.1	T	A	14: 43,300,788	F97I		Het
Ankmy2	T	C	12: 36,196,312	S412P	probably benign	Het
Ap1s3	T	C	1: 79,609,202	T144A	probably benign	Het
Asb3	T	A	11: 30,998,501	L59*	probably null	Het
Asxl3	G	T	18: 22,517,701	G916*	probably null	Het
Asxl3	G	C	18: 22,517,702	G916A	probably damaging	Het
Birc2	A	C	9: 7,818,761	F610V	probably damaging	Het
Camk4	G	A	18: 33,107,943		probably null	Het
Ccdc162	A	G	10: 41,673,859	S343P	probably benign	Het
Ccnk	T	A	12: 108,186,475	L17Q	probably damaging	Het
Cd59b	G	A	2: 104,084,447	W63*	probably null	Het
Chrm3	C	T	13: 9,877,801	V400I	probably benign	Het
Crb1	C	A	1: 139,243,367	V762F	probably damaging	Het
Cspp1	C	T	1: 10,088,936	T529I	possibly damaging	Het
Cttnbp2	A	G	6: 18,448,447	I71T	possibly damaging	Het
Cyb561	C	A	11: 105,935,567	G90V	probably damaging	Het
Cyld	T	A	8: 88,744,892	D804E	possibly damaging	Het
Ddx31	G	A	2: 28,848,306	V160I	probably benign	Het
Dgkg	T	C	16: 22,500,382	D643G	probably damaging	Het
Dnah12	G	A	14: 26,778,912		probably null	Het
Dnah12	T	G	14: 26,801,413	I1953S	probably damaging	Het
Dnah7b	T	C	1: 46,139,710	W848R	probably damaging	Het
Dnah7c	C	T	1: 46,533,208	T947M	probably damaging	Het
Dnmt3c	C	A	2: 153,714,952		probably null	Het
Dsp	A	T	13: 38,179,073	Y443F	probably damaging	Het
Faiml	G	T	9: 99,234,443	R65S	probably benign	Het
Gfpt2	T	C	11: 49,804,955	I4T	probably damaging	Het
Gm10376	T	A	14: 43,010,493	M179L	probably benign	Het
Gm13084	A	T	4: 143,810,663	L366Q	probably damaging	Het
Gm4302	T	A	10: 100,341,727	M291K	unknown	Het
Gm8906	C	T	5: 11,505,231	P83S	probably damaging	Het
Gnb1l	T	A	16: 18,545,168	D154E	probably benign	Het
Igkv10-94	T	C	6: 68,704,743	R38G	possibly damaging	Het
Inmt	A	T	6: 55,171,028	Y205*	probably null	Het
Krba1	A	G	6: 48,416,299	Q1049R	probably benign	Het
Lpxn	T	A	19: 12,833,319	C376S	probably damaging	Het
Lrrc52	T	A	1: 167,466,450	I89F	probably damaging	Het
Map9	A	T	3: 82,363,458	T110S	probably benign	Het
Mccc1	T	C	3: 35,995,818	Y75C	probably damaging	Het
Mff	T	A	1: 82,747,091	L203*	probably null	Het
Micall1	C	A	15: 79,109,424	D47E	unknown	Het
Mink1	T	C	11: 70,603,503	F243S	probably damaging	Het
Mlycd	C	T	8: 119,402,477	R228W	probably damaging	Het
Msr1	A	T	8: 39,589,424	V370E	possibly damaging	Het
Naip6	T	C	13: 100,300,419	E532G	probably damaging	Het
Nepn	G	A	10: 52,391,719	C27Y	probably damaging	Het
Ninl	T	C	2: 150,955,604	H592R	probably benign	Het
Nr4a2	A	G	2: 57,112,249	M64T	possibly damaging	Het
Olfr1279	T	A	2: 111,307,020	F272I	probably benign	Het
Olfr484	T	C	7: 108,124,574	K230E	probably damaging	Het
Oprm1	A	T	10: 6,830,203	I171F	possibly damaging	Het
Pcbp1	A	T	6: 86,525,506	M137K	possibly damaging	Het
Pcf11	A	T	7: 92,657,316	S1215T	probably benign	Het
Pdlim5	A	T	3: 142,311,922		probably null	Het
Pecam1	T	C	11: 106,689,031	I402V	probably damaging	Het
Pex12	T	C	11: 83,297,642	T176A	probably benign	Het
Phf3	T	C	1: 30,831,109	K286R	possibly damaging	Het
Pik3ap1	T	A	19: 41,332,321	D153V	probably damaging	Het
Pkhd1l1	T	A	15: 44,584,978		probably null	Het
Plekhn1	A	G	4: 156,223,335	V378A	probably benign	Het
Ptprm	A	T	17: 66,944,288	D531E	possibly damaging	Het
Pum2	A	T	12: 8,728,952	Q508L	possibly damaging	Het
Rad54l	A	G	4: 116,105,830	S324P	probably damaging	Het
Recql5	C	T	11: 115,930,672		probably null	Het
Reln	A	T	5: 21,976,596	V1763D	possibly damaging	Het
Rp1	T	C	1: 4,348,168	N907S	possibly damaging	Het
Scaf11	T	A	15: 96,420,328	N452Y	possibly damaging	Het
Scgb2b3	T	A	7: 31,360,214	H45L	possibly damaging	Het
Sim1	A	G	10: 50,895,927	T11A	probably damaging	Het
Slc5a12	T	A	2: 110,616,714	M189K	possibly damaging	Het
Slco2b1	C	T	7: 99,695,063	G10S	probably null	Het
Stxbp3	A	G	3: 108,800,755	L410P	probably damaging	Het
Sugct	T	C	13: 17,302,009	N297D	probably benign	Het
Syne1	A	G	10: 5,233,409	I4132T	probably benign	Het
Teddm1b	A	T	1: 153,875,166	L240F	probably damaging	Het
Tlr5	C	A	1: 182,975,523	D797E	possibly damaging	Het
Tmprss13	G	T	9: 45,338,345	G327C	probably damaging	Het
Tnrc18	G	T	5: 142,787,817	A419D		Het
Ttc28	T	C	5: 111,280,007	Y1790H	probably damaging	Het
Vmn1r125	T	G	7: 21,272,402	M75R	probably damaging	Het
Vwa3a	T	A	7: 120,773,030	D276E	possibly damaging	Het
Wdfy3	C	T	5: 101,915,437	V1322M	probably damaging	Het
Wdr11	T	C	7: 129,628,106	S872P	possibly damaging	Het
Zc3h13	T	C	14: 75,321,721	S357P	unknown	Het

Other mutations in Espl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00821:Espl1	APN	15	102299813	missense	probably damaging	1.00
IGL00839:Espl1	APN	15	102320547	unclassified	probably benign
IGL00919:Espl1	APN	15	102298629	missense	probably benign	0.03
IGL01125:Espl1	APN	15	102322938	missense	probably damaging	1.00
IGL01366:Espl1	APN	15	102319836	missense	probably benign	0.00
IGL01488:Espl1	APN	15	102298739	missense	probably benign
IGL01554:Espl1	APN	15	102313225	missense	probably damaging	1.00
IGL01810:Espl1	APN	15	102298205	missense	probably benign
IGL01959:Espl1	APN	15	102305662	splice site	probably benign
IGL02267:Espl1	APN	15	102315664	missense	probably benign	0.01
IGL02452:Espl1	APN	15	102299839	missense	probably damaging	1.00
IGL02469:Espl1	APN	15	102314025	missense	probably damaging	1.00
IGL02500:Espl1	APN	15	102315800	missense	probably benign
IGL02630:Espl1	APN	15	102296818	missense	probably benign	0.11
IGL02687:Espl1	APN	15	102313178	splice site	probably benign
IGL02868:Espl1	APN	15	102313990	nonsense	probably null
IGL02926:Espl1	APN	15	102299855	missense	probably damaging	0.99
R0019:Espl1	UTSW	15	102306319	missense	probably null	0.01
R0129:Espl1	UTSW	15	102316648	missense	probably benign	0.00
R0184:Espl1	UTSW	15	102299216	missense	probably benign	0.01
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0240:Espl1	UTSW	15	102312541	missense	probably benign	0.00
R0267:Espl1	UTSW	15	102313017	missense	possibly damaging	0.89
R0423:Espl1	UTSW	15	102303986	nonsense	probably null
R0587:Espl1	UTSW	15	102303947	splice site	probably benign
R0726:Espl1	UTSW	15	102322598	missense	probably benign
R1186:Espl1	UTSW	15	102304039	missense	probably benign	0.05
R1282:Espl1	UTSW	15	102315391	missense	probably benign	0.00
R1428:Espl1	UTSW	15	102305685	missense	probably benign	0.06
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1467:Espl1	UTSW	15	102319858	missense	probably benign	0.09
R1473:Espl1	UTSW	15	102320443	missense	possibly damaging	0.63
R1570:Espl1	UTSW	15	102298367	missense	probably damaging	0.98
R1639:Espl1	UTSW	15	102320714	missense	probably damaging	1.00
R1725:Espl1	UTSW	15	102313221	missense	probably benign	0.08
R1748:Espl1	UTSW	15	102298529	missense	possibly damaging	0.92
R1845:Espl1	UTSW	15	102299013	missense	probably benign
R1938:Espl1	UTSW	15	102305042	missense	probably benign	0.00
R1954:Espl1	UTSW	15	102298388	missense	probably damaging	1.00
R2009:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2014:Espl1	UTSW	15	102322714	nonsense	probably null
R2067:Espl1	UTSW	15	102299090	missense	probably damaging	0.96
R2084:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R2164:Espl1	UTSW	15	102319588	missense	probably damaging	1.00
R2204:Espl1	UTSW	15	102305905	missense	probably damaging	1.00
R2220:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R2237:Espl1	UTSW	15	102315569	missense	probably damaging	0.98
R2314:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3107:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3108:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3114:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3115:Espl1	UTSW	15	102323204	missense	possibly damaging	0.89
R3615:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3616:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3732:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3733:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3958:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3959:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R3960:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4062:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4063:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4064:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4165:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4166:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4349:Espl1	UTSW	15	102319604	missense	probably benign	0.26
R4373:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4376:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4377:Espl1	UTSW	15	102312989	missense	probably damaging	0.99
R4516:Espl1	UTSW	15	102323236	missense	probably benign	0.00
R4595:Espl1	UTSW	15	102298724	missense	probably benign	0.01
R4884:Espl1	UTSW	15	102324070	missense	possibly damaging	0.84
R4894:Espl1	UTSW	15	102322323	critical splice acceptor site	probably null
R4921:Espl1	UTSW	15	102315241	missense	probably damaging	0.98
R4931:Espl1	UTSW	15	102305730	missense	probably benign	0.02
R4936:Espl1	UTSW	15	102304937	missense	probably damaging	1.00
R5000:Espl1	UTSW	15	102298551	missense	probably damaging	1.00
R5220:Espl1	UTSW	15	102298577	missense	probably benign	0.03
R5329:Espl1	UTSW	15	102312518	missense	probably damaging	0.97
R5501:Espl1	UTSW	15	102317130	missense	possibly damaging	0.51
R5788:Espl1	UTSW	15	102324030	missense	probably damaging	1.00
R5848:Espl1	UTSW	15	102322576	missense	probably benign	0.03
R5906:Espl1	UTSW	15	102296851	critical splice donor site	probably null
R5978:Espl1	UTSW	15	102315774	missense	possibly damaging	0.66
R6111:Espl1	UTSW	15	102299888	missense	probably damaging	0.99
R6313:Espl1	UTSW	15	102315812	missense	probably benign	0.00
R6414:Espl1	UTSW	15	102315560	missense	probably damaging	0.96
R6484:Espl1	UTSW	15	102323500	missense	possibly damaging	0.65
R6784:Espl1	UTSW	15	102299225	missense	probably benign
R6928:Espl1	UTSW	15	102298907	missense	probably benign	0.28
R6995:Espl1	UTSW	15	102304100	missense	possibly damaging	0.94
R7053:Espl1	UTSW	15	102316893	critical splice donor site	probably null
R7062:Espl1	UTSW	15	102298896	missense	probably benign	0.00
R7154:Espl1	UTSW	15	102324049	missense	probably damaging	1.00
R7164:Espl1	UTSW	15	102313203	missense	probably damaging	1.00
R7522:Espl1	UTSW	15	102305051	missense	probably damaging	1.00
R7848:Espl1	UTSW	15	102316526	missense	probably damaging	1.00
R7894:Espl1	UTSW	15	102304025	missense	probably damaging	1.00
R8275:Espl1	UTSW	15	102302753	splice site	probably benign
R8752:Espl1	UTSW	15	102306324	missense	probably damaging	1.00
R9160:Espl1	UTSW	15	102298518	missense	probably damaging	1.00
R9310:Espl1	UTSW	15	102296850	critical splice donor site	probably null
R9385:Espl1	UTSW	15	102298750	missense	probably damaging	0.99
R9532:Espl1	UTSW	15	102319825	nonsense	probably null
R9563:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9565:Espl1	UTSW	15	102319798	missense	possibly damaging	0.82
R9723:Espl1	UTSW	15	102320735	missense	probably benign	0.43
X0062:Espl1	UTSW	15	102298397	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTTCCTAGTAATTAAGAAGCAGGATGC -3'
(R):5'- ACAACACAAGAATGAGTCTGGC -3'

Sequencing Primer
(F):5'- CGAATTTCTGAGTTTGAGACCAGCC -3'
(R):5'- CAAGAATGAGTCTGGCTCCTTTCAG -3'

Posted On

2019-05-15