Incidental Mutation 'R7136:Fam227b'
ID 553046
Institutional Source Beutler Lab
Gene Symbol Fam227b
Ensembl Gene ENSMUSG00000027209
Gene Name family with sequence similarity 227, member B
Synonyms 4930525F21Rik
MMRRC Submission 045220-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R7136 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 125825403-125993924 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 125965948 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 159 (Q159P)
Ref Sequence ENSEMBL: ENSMUSP00000106076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110446] [ENSMUST00000110448] [ENSMUST00000178118]
AlphaFold Q9D518
Predicted Effect probably damaging
Transcript: ENSMUST00000110446
AA Change: Q159P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106076
Gene: ENSMUSG00000027209
AA Change: Q159P

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 7.6e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110448
AA Change: Q159P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000106078
Gene: ENSMUSG00000027209
AA Change: Q159P

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 136 293 3.8e-54 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178118
AA Change: Q159P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136349
Gene: ENSMUSG00000027209
AA Change: Q159P

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:FWWh 140 293 7.2e-50 PFAM
coiled coil region 427 478 N/A INTRINSIC
low complexity region 500 523 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123K08Rik A G 5: 138,560,610 (GRCm39) S262P probably damaging Het
Abcc2 A G 19: 43,825,899 (GRCm39) E1512G probably damaging Het
Abcg2 T G 6: 58,661,325 (GRCm39) Y459D possibly damaging Het
Amy1 T C 3: 113,357,248 (GRCm39) Y197C probably damaging Het
Bptf A G 11: 106,990,541 (GRCm39) I516T probably damaging Het
Capn12 T A 7: 28,582,532 (GRCm39) probably null Het
Cbln2 T A 18: 86,734,797 (GRCm39) L190Q probably damaging Het
Ccdc157 C T 11: 4,098,592 (GRCm39) E305K possibly damaging Het
Ccdc47 A G 11: 106,095,830 (GRCm39) S289P probably benign Het
Chd3 C T 11: 69,239,264 (GRCm39) E1756K probably null Het
Chrd G T 16: 20,553,272 (GRCm39) A183S possibly damaging Het
Cp C T 3: 20,039,822 (GRCm39) R880* probably null Het
Cyp24a1 A T 2: 170,336,063 (GRCm39) D191E probably benign Het
Dnah1 T C 14: 31,020,613 (GRCm39) Y1252C probably damaging Het
Eps8l1 A G 7: 4,480,403 (GRCm39) D487G probably damaging Het
Fat3 A G 9: 16,289,481 (GRCm39) I14T probably benign Het
Fbxl19 C A 7: 127,349,217 (GRCm39) T129N possibly damaging Het
Fuca2 T C 10: 13,381,665 (GRCm39) F193L probably benign Het
H2-Q1 T C 17: 35,539,603 (GRCm39) probably null Het
Hgh1 A G 15: 76,254,631 (GRCm39) M336V probably benign Het
Il12b T C 11: 44,298,857 (GRCm39) L104P probably benign Het
Kcnh2 A T 5: 24,537,989 (GRCm39) F125I probably benign Het
Kcnk7 A G 19: 5,756,104 (GRCm39) H110R probably benign Het
Kdm3a G A 6: 71,588,764 (GRCm39) P415L probably benign Het
Kifc3 T C 8: 95,830,077 (GRCm39) T610A probably benign Het
Krbox5 A G 13: 67,991,111 (GRCm39) probably null Het
Lmbr1l C A 15: 98,809,372 (GRCm39) probably null Het
Lmo7 T A 14: 102,157,975 (GRCm39) M1436K unknown Het
Lrp1 C T 10: 127,394,491 (GRCm39) C2574Y probably damaging Het
Med13l A G 5: 118,859,587 (GRCm39) E258G possibly damaging Het
Mesp1 T C 7: 79,442,906 (GRCm39) I124V probably damaging Het
Mrgpra2a A T 7: 47,076,934 (GRCm39) I108N probably benign Het
Nos1 G T 5: 118,033,925 (GRCm39) R349L possibly damaging Het
Or5k3 C T 16: 58,969,327 (GRCm39) T38I probably damaging Het
Or7c70 T C 10: 78,683,615 (GRCm39) I45V probably benign Het
Osgin1 T A 8: 120,168,176 (GRCm39) M1K probably null Het
Pde4dip C T 3: 97,601,379 (GRCm39) S2346N probably benign Het
Pde7a T C 3: 19,285,258 (GRCm39) M310V probably benign Het
Pigw G A 11: 84,768,585 (GRCm39) T248M probably damaging Het
Pink1 T C 4: 138,044,769 (GRCm39) T323A probably damaging Het
Polr3a C T 14: 24,511,883 (GRCm39) R891Q probably damaging Het
Prkar1b C A 5: 139,094,363 (GRCm39) C75F probably benign Het
Prss58 C T 6: 40,876,987 (GRCm39) probably null Het
Ptk2 G A 15: 73,093,658 (GRCm39) P854S possibly damaging Het
Pttg1ip2 A T 5: 5,516,631 (GRCm39) D63E possibly damaging Het
Qars1 T C 9: 108,389,971 (GRCm39) I350T probably damaging Het
Qprt T C 7: 126,707,984 (GRCm39) K149R probably damaging Het
Rasgrf1 T A 9: 89,873,651 (GRCm39) D653E probably damaging Het
Rbm26 T C 14: 105,381,703 (GRCm39) M481V possibly damaging Het
Rdx C T 9: 51,997,745 (GRCm39) T573M probably damaging Het
Rgs14 A G 13: 55,527,508 (GRCm39) probably null Het
Robo2 T C 16: 73,753,438 (GRCm39) E813G probably damaging Het
Rrbp1 A T 2: 143,791,600 (GRCm39) F1369I probably benign Het
Sh2d4b T A 14: 40,562,209 (GRCm39) T319S probably benign Het
Slc7a15 G T 12: 8,588,895 (GRCm39) N217K probably damaging Het
Stmn1 A G 4: 134,198,088 (GRCm39) K42E probably damaging Het
Tbl2 T G 5: 135,178,682 (GRCm39) W31G probably benign Het
Tmem8b T C 4: 43,669,845 (GRCm39) C114R possibly damaging Het
Tsc2 T C 17: 24,832,254 (GRCm39) S711G probably benign Het
Ttn T C 2: 76,666,904 (GRCm39) R11531G unknown Het
Ube2e3 T C 2: 78,744,085 (GRCm39) Y105H probably benign Het
Usp16 G T 16: 87,280,059 (GRCm39) C753F probably benign Het
Vmn1r13 T C 6: 57,187,239 (GRCm39) S133P possibly damaging Het
Vmn2r76 T A 7: 85,877,975 (GRCm39) Q474L probably benign Het
Vps52 T C 17: 34,184,262 (GRCm39) I601T probably benign Het
Wasf1 A T 10: 40,802,587 (GRCm39) T81S possibly damaging Het
Wdr82 A G 9: 106,048,532 (GRCm39) S39G probably benign Het
Zdhhc13 A G 7: 48,451,080 (GRCm39) I108V probably benign Het
Other mutations in Fam227b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Fam227b APN 2 125,986,245 (GRCm39) critical splice acceptor site probably null
IGL00970:Fam227b APN 2 125,968,980 (GRCm39) missense probably benign 0.01
IGL02040:Fam227b APN 2 125,963,004 (GRCm39) splice site probably benign
IGL02095:Fam227b APN 2 125,942,924 (GRCm39) missense probably damaging 0.97
IGL02352:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02359:Fam227b APN 2 125,988,174 (GRCm39) unclassified probably benign
IGL02506:Fam227b APN 2 125,845,831 (GRCm39) missense probably benign 0.22
IGL02717:Fam227b APN 2 125,845,763 (GRCm39) missense probably null 0.97
IGL02933:Fam227b APN 2 125,965,908 (GRCm39) splice site probably null
IGL03064:Fam227b APN 2 125,968,762 (GRCm39) splice site probably null
IGL03086:Fam227b APN 2 125,960,951 (GRCm39) missense probably benign 0.01
IGL03198:Fam227b APN 2 125,966,499 (GRCm39) critical splice donor site probably null
IGL03256:Fam227b APN 2 125,830,923 (GRCm39) missense probably damaging 0.99
IGL03368:Fam227b APN 2 125,960,983 (GRCm39) missense probably damaging 1.00
dana UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0071:Fam227b UTSW 2 125,965,994 (GRCm39) missense probably benign 0.04
R0110:Fam227b UTSW 2 125,942,841 (GRCm39) missense probably damaging 1.00
R0140:Fam227b UTSW 2 125,966,523 (GRCm39) missense possibly damaging 0.53
R0377:Fam227b UTSW 2 125,966,920 (GRCm39) splice site probably benign
R0499:Fam227b UTSW 2 125,942,829 (GRCm39) missense probably benign 0.25
R1240:Fam227b UTSW 2 125,966,505 (GRCm39) missense possibly damaging 0.56
R1356:Fam227b UTSW 2 125,960,928 (GRCm39) missense probably damaging 1.00
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R1404:Fam227b UTSW 2 125,845,759 (GRCm39) missense probably damaging 0.99
R2055:Fam227b UTSW 2 125,942,874 (GRCm39) missense probably benign 0.13
R2884:Fam227b UTSW 2 125,942,846 (GRCm39) missense probably benign 0.01
R3124:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3125:Fam227b UTSW 2 125,966,006 (GRCm39) missense probably benign 0.36
R3937:Fam227b UTSW 2 125,968,980 (GRCm39) missense probably benign 0.01
R4408:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4454:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4455:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4457:Fam227b UTSW 2 125,988,188 (GRCm39) unclassified probably benign
R4558:Fam227b UTSW 2 125,968,963 (GRCm39) missense probably benign 0.00
R4661:Fam227b UTSW 2 125,849,230 (GRCm39) missense probably damaging 0.99
R4809:Fam227b UTSW 2 125,958,045 (GRCm39) missense possibly damaging 0.47
R4810:Fam227b UTSW 2 125,829,859 (GRCm39) missense probably benign 0.01
R4989:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5011:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5013:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5014:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5133:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5184:Fam227b UTSW 2 125,958,043 (GRCm39) missense probably damaging 1.00
R5431:Fam227b UTSW 2 125,968,851 (GRCm39) missense probably benign 0.09
R5797:Fam227b UTSW 2 125,849,254 (GRCm39) missense probably benign
R6056:Fam227b UTSW 2 125,962,972 (GRCm39) missense probably damaging 1.00
R6218:Fam227b UTSW 2 125,968,882 (GRCm39) missense probably damaging 1.00
R6471:Fam227b UTSW 2 125,962,985 (GRCm39) missense probably damaging 1.00
R6660:Fam227b UTSW 2 125,986,227 (GRCm39) missense probably damaging 1.00
R6734:Fam227b UTSW 2 125,968,896 (GRCm39) nonsense probably null
R7410:Fam227b UTSW 2 125,960,983 (GRCm39) missense probably damaging 1.00
R8417:Fam227b UTSW 2 125,962,982 (GRCm39) missense probably damaging 1.00
R8679:Fam227b UTSW 2 125,830,928 (GRCm39) missense probably benign 0.02
R8731:Fam227b UTSW 2 125,968,898 (GRCm39) missense possibly damaging 0.95
R8986:Fam227b UTSW 2 125,958,019 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAACAGGGTTAGACATCACTAATG -3'
(R):5'- ATTGGCTCATGAATATGCAAAGGC -3'

Sequencing Primer
(F):5'- GTTCAAAGAATCAAGCGTTGT -3'
(R):5'- GCAAAGGCATTTAATTTTTCAGAAAC -3'
Posted On 2019-05-15