Incidental Mutation 'R7136:Kdm3a'
ID553066
Institutional Source Beutler Lab
Gene Symbol Kdm3a
Ensembl Gene ENSMUSG00000053470
Gene Namelysine (K)-specific demethylase 3A
SynonymsC230043E16Rik, Jmjd1a, Tsga, 1700105C21Rik, Jmjd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R7136 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location71588972-71632990 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 71611780 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 415 (P415L)
Ref Sequence ENSEMBL: ENSMUSP00000065716 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065509] [ENSMUST00000167220] [ENSMUST00000205289] [ENSMUST00000207023]
Predicted Effect probably benign
Transcript: ENSMUST00000065509
AA Change: P415L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065716
Gene: ENSMUSG00000053470
AA Change: P415L

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167220
AA Change: P415L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128789
Gene: ENSMUSG00000053470
AA Change: P415L

DomainStartEndE-ValueType
low complexity region 853 859 N/A INTRINSIC
JmjC 1060 1283 1.6e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205289
AA Change: P415L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000206916
Predicted Effect probably benign
Transcript: ENSMUST00000207023
AA Change: P415L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger protein that contains a jumonji domain and may play a role in hormone-dependent transcriptional activation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
PHENOTYPE: Male mice homozygous for a hypomorphic allele display infertility, oligoasthenoteratozoospermia, small testis, and impaired spermiogenesis. Mice homozygous for a null allele exhibit abnormal spermatogenesis and obesity associated with hyperlipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,466,631 D63E possibly damaging Het
1700123K08Rik A G 5: 138,562,348 S262P probably damaging Het
Abcc2 A G 19: 43,837,460 E1512G probably damaging Het
Abcg2 T G 6: 58,684,340 Y459D possibly damaging Het
Amy1 T C 3: 113,563,599 Y197C probably damaging Het
Bptf A G 11: 107,099,715 I516T probably damaging Het
Capn12 T A 7: 28,883,107 probably null Het
Cbln2 T A 18: 86,716,672 L190Q probably damaging Het
Ccdc157 C T 11: 4,148,592 E305K possibly damaging Het
Ccdc47 A G 11: 106,205,004 S289P probably benign Het
Chd3 C T 11: 69,348,438 E1756K probably null Het
Chrd G T 16: 20,734,522 A183S possibly damaging Het
Cp C T 3: 19,985,658 R880* probably null Het
Cyp24a1 A T 2: 170,494,143 D191E probably benign Het
Dnah1 T C 14: 31,298,656 Y1252C probably damaging Het
Eps8l1 A G 7: 4,477,404 D487G probably damaging Het
Fam227b T G 2: 126,124,028 Q159P probably damaging Het
Fat3 A G 9: 16,378,185 I14T probably benign Het
Fbxl19 C A 7: 127,750,045 T129N possibly damaging Het
Fuca2 T C 10: 13,505,921 F193L probably benign Het
Gm10037 A G 13: 67,842,992 probably null Het
H2-Q1 T C 17: 35,320,627 probably null Het
Hgh1 A G 15: 76,370,431 M336V probably benign Het
Il12b T C 11: 44,408,030 L104P probably benign Het
Kcnh2 A T 5: 24,332,991 F125I probably benign Het
Kcnk7 A G 19: 5,706,076 H110R probably benign Het
Kifc3 T C 8: 95,103,449 T610A probably benign Het
Lmbr1l C A 15: 98,911,491 probably null Het
Lmo7 T A 14: 101,920,539 M1436K unknown Het
Lrp1 C T 10: 127,558,622 C2574Y probably damaging Het
Med13l A G 5: 118,721,522 E258G possibly damaging Het
Mesp1 T C 7: 79,793,158 I124V probably damaging Het
Mrgpra2a A T 7: 47,427,186 I108N probably benign Het
Nos1 G T 5: 117,895,860 R349L possibly damaging Het
Olfr1356 T C 10: 78,847,781 I45V probably benign Het
Olfr195 C T 16: 59,148,964 T38I probably damaging Het
Osgin1 T A 8: 119,441,437 M1K probably null Het
Pde4dip C T 3: 97,694,063 S2346N probably benign Het
Pde7a T C 3: 19,231,094 M310V probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pink1 T C 4: 138,317,458 T323A probably damaging Het
Polr3a C T 14: 24,461,815 R891Q probably damaging Het
Prkar1b C A 5: 139,108,608 C75F probably benign Het
Prss58 C T 6: 40,900,053 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Qars T C 9: 108,512,772 I350T probably damaging Het
Qprt T C 7: 127,108,812 K149R probably damaging Het
Rasgrf1 T A 9: 89,991,598 D653E probably damaging Het
Rbm26 T C 14: 105,144,267 M481V possibly damaging Het
Rdx C T 9: 52,086,445 T573M probably damaging Het
Rgs14 A G 13: 55,379,695 probably null Het
Robo2 T C 16: 73,956,550 E813G probably damaging Het
Rrbp1 A T 2: 143,949,680 F1369I probably benign Het
Sh2d4b T A 14: 40,840,252 T319S probably benign Het
Slc7a15 G T 12: 8,538,895 N217K probably damaging Het
Stmn1 A G 4: 134,470,777 K42E probably damaging Het
Tbl2 T G 5: 135,149,828 W31G probably benign Het
Tmem8b T C 4: 43,669,845 C114R possibly damaging Het
Tsc2 T C 17: 24,613,280 S711G probably benign Het
Ttn T C 2: 76,836,560 R11531G unknown Het
Ube2e3 T C 2: 78,913,741 Y105H probably benign Het
Usp16 G T 16: 87,483,171 C753F probably benign Het
Vmn1r13 T C 6: 57,210,254 S133P possibly damaging Het
Vmn2r76 T A 7: 86,228,767 Q474L probably benign Het
Vps52 T C 17: 33,965,288 I601T probably benign Het
Wasf1 A T 10: 40,926,591 T81S possibly damaging Het
Wdr82 A G 9: 106,171,333 S39G probably benign Het
Zdhhc13 A G 7: 48,801,332 I108V probably benign Het
Other mutations in Kdm3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02168:Kdm3a APN 6 71600117 missense probably damaging 1.00
IGL02219:Kdm3a APN 6 71600734 missense probably benign 0.01
IGL02423:Kdm3a APN 6 71614003 splice site probably benign
IGL02427:Kdm3a APN 6 71592200 splice site probably benign
IGL02519:Kdm3a APN 6 71611586 missense probably benign 0.04
IGL03143:Kdm3a APN 6 71596861 missense probably damaging 0.98
IGL03279:Kdm3a APN 6 71611675 missense probably benign
R0194:Kdm3a UTSW 6 71624594 missense probably null 0.44
R0408:Kdm3a UTSW 6 71611679 missense probably benign 0.00
R0426:Kdm3a UTSW 6 71600755 missense probably damaging 1.00
R0608:Kdm3a UTSW 6 71620046 missense probably benign 0.01
R1175:Kdm3a UTSW 6 71600027 missense possibly damaging 0.94
R1835:Kdm3a UTSW 6 71613956 missense probably benign 0.14
R3821:Kdm3a UTSW 6 71611677 missense probably benign 0.00
R5083:Kdm3a UTSW 6 71621362 missense probably damaging 1.00
R5536:Kdm3a UTSW 6 71611936 missense probably benign 0.31
R5903:Kdm3a UTSW 6 71632250 start gained probably benign
R5965:Kdm3a UTSW 6 71621380 missense probably benign 0.21
R6236:Kdm3a UTSW 6 71611657 missense probably benign 0.00
R6541:Kdm3a UTSW 6 71594533 missense possibly damaging 0.69
R6666:Kdm3a UTSW 6 71611990 missense probably benign 0.00
R7090:Kdm3a UTSW 6 71595545 missense possibly damaging 0.69
R7112:Kdm3a UTSW 6 71632170 missense probably benign
R7163:Kdm3a UTSW 6 71632077 missense probably damaging 1.00
R7608:Kdm3a UTSW 6 71600747 missense probably benign 0.01
R7614:Kdm3a UTSW 6 71591953 missense possibly damaging 0.82
R7683:Kdm3a UTSW 6 71599454 missense probably benign
R7687:Kdm3a UTSW 6 71599492 missense possibly damaging 0.64
R7868:Kdm3a UTSW 6 71595489 missense probably benign 0.31
R8447:Kdm3a UTSW 6 71611897 missense probably benign
RF053:Kdm3a UTSW 6 71632049 critical splice donor site probably benign
Predicted Primers PCR Primer
(F):5'- ACCTAAATGTGAAGGTTCGACC -3'
(R):5'- GTCATAAGCAGAACTTACCAGAAG -3'

Sequencing Primer
(F):5'- CTTCTTTTCTGCACAACTATTAAGGC -3'
(R):5'- TTCTTCCTGTCTAAACACAAAACCTG -3'
Posted On2019-05-15