Incidental Mutation 'R0600:Olfr495'
ID55307
Institutional Source Beutler Lab
Gene Symbol Olfr495
Ensembl Gene ENSMUSG00000110253
Gene Nameolfactory receptor 495
SynonymsMOR204-37, GA_x6K02T2PBJ9-10725148-10726140
MMRRC Submission 038789-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R0600 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108393167-108397513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 108395231 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 37 (I37N)
Ref Sequence ENSEMBL: ENSMUSP00000150689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000210990] [ENSMUST00000215215]
Predicted Effect probably damaging
Transcript: ENSMUST00000071505
AA Change: I37N

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071440
Gene: ENSMUSG00000094104
AA Change: I37N

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 3.6e-51 PFAM
Pfam:7tm_1 44 293 2.7e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000210990
AA Change: I37N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000215215
AA Change: I37N

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,357,660 S150P probably damaging Het
4932431P20Rik T A 7: 29,533,265 noncoding transcript Het
5530400C23Rik T G 6: 133,293,211 probably benign Het
Ahctf1 A C 1: 179,763,468 probably null Het
Ang5 T C 14: 43,962,749 V90A probably benign Het
Ano9 C T 7: 141,104,710 G442R probably damaging Het
Apaf1 G A 10: 91,060,052 T386I probably damaging Het
Apob C A 12: 8,006,440 H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 probably benign Het
Asxl1 T A 2: 153,399,904 D791E probably benign Het
Avl9 T C 6: 56,736,906 V383A probably benign Het
Btbd1 A C 7: 81,816,006 D197E probably damaging Het
C87499 A T 4: 88,629,299 I45K probably damaging Het
Camta2 T C 11: 70,673,959 I938V possibly damaging Het
Cdca7 C A 2: 72,483,467 A200D possibly damaging Het
Cep104 A T 4: 154,006,792 Y923F possibly damaging Het
Cep135 G C 5: 76,621,305 V601L probably benign Het
Ces2b G A 8: 104,835,910 G291S probably benign Het
Col6a6 C T 9: 105,761,440 G1400D probably damaging Het
Cyth2 T C 7: 45,813,117 E1G probably damaging Het
Dand5 A T 8: 84,816,292 L185Q probably damaging Het
Dck T C 5: 88,781,221 V253A probably benign Het
Ddx20 A G 3: 105,679,080 S650P probably damaging Het
Dicer1 G A 12: 104,706,864 P799S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eya2 G A 2: 165,769,237 C477Y probably damaging Het
Fam208b A T 13: 3,576,054 F1299I probably benign Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Galntl6 T C 8: 57,837,183 probably null Het
Gda A T 19: 21,434,303 F44I possibly damaging Het
Gli2 G A 1: 118,840,389 R703C probably damaging Het
Gm14085 A T 2: 122,514,398 I162F probably damaging Het
Golgb1 T A 16: 36,916,271 L1960Q probably damaging Het
Gramd1b T C 9: 40,308,355 D341G probably damaging Het
Grid2 G T 6: 63,503,435 A78S probably benign Het
Hao2 A T 3: 98,883,560 probably benign Het
Hook3 A G 8: 26,118,986 V10A probably benign Het
Kif20a A G 18: 34,629,209 E425G probably damaging Het
Lrp1 T C 10: 127,567,383 D2107G probably benign Het
Lrriq3 T C 3: 155,187,736 I358T possibly damaging Het
Mad2l2 A G 4: 148,140,924 D17G possibly damaging Het
Mastl G T 2: 23,133,346 T455K probably benign Het
Mkln1 G T 6: 31,432,927 probably benign Het
Mmp1b A T 9: 7,387,947 Y16N possibly damaging Het
Mmp24 C T 2: 155,792,597 A79V probably benign Het
Mrps35 T A 6: 147,070,734 C292S possibly damaging Het
Myom1 T C 17: 71,120,648 F1435L possibly damaging Het
Nars2 C T 7: 97,039,923 H351Y probably damaging Het
Nat2 A T 8: 67,501,267 I10F probably damaging Het
Nfix G A 8: 84,726,526 R300C probably damaging Het
Olfm5 A T 7: 104,153,869 Y462* probably null Het
Olfr1228 C A 2: 89,249,398 E87* probably null Het
Olfr1339 C T 4: 118,734,789 H87Y probably damaging Het
Olfr1508 T C 14: 52,463,509 I167V probably benign Het
Olfr322 C A 11: 58,666,160 F200L probably damaging Het
Olfr340 C A 2: 36,452,648 A21E probably benign Het
Olfr44 A T 9: 39,484,988 F85L probably benign Het
Olfr855 T C 9: 19,585,304 S256P possibly damaging Het
Olfr926 T A 9: 38,877,815 I213N probably damaging Het
Otog A T 7: 46,251,395 probably benign Het
Pdcd2l A T 7: 34,192,807 D212E possibly damaging Het
Pex5 T C 6: 124,404,637 N213S probably benign Het
Pkn3 C T 2: 30,081,134 P238S probably benign Het
Prl2b1 A T 13: 27,390,740 probably null Het
Ptprb A T 10: 116,368,807 I1849L possibly damaging Het
Rasal3 G T 17: 32,393,526 S787Y probably damaging Het
Scn2a T A 2: 65,701,833 D596E possibly damaging Het
Sdhd A T 9: 50,603,764 V9D possibly damaging Het
Serinc5 T C 13: 92,708,057 S436P probably damaging Het
Slc27a1 C T 8: 71,584,164 P348L probably damaging Het
Smg1 G A 7: 118,160,383 probably benign Het
Sorl1 A T 9: 42,043,900 probably benign Het
Sprtn T A 8: 124,900,218 H112Q probably damaging Het
Tet2 A G 3: 133,467,602 M1633T probably benign Het
Tet2 T A 3: 133,467,725 D1592V probably benign Het
Tmem68 A T 4: 3,569,667 C8S probably damaging Het
Tnrc6a T A 7: 123,171,816 I943N probably benign Het
Trib2 A T 12: 15,794,068 V191D probably damaging Het
Tsc22d4 T C 5: 137,762,655 S113P probably damaging Het
Ttc21b T C 2: 66,239,570 R250G probably damaging Het
Ubr2 T C 17: 46,967,248 Y721C probably damaging Het
Ubtfl1 A T 9: 18,409,364 I63F probably damaging Het
Ush1c G A 7: 46,224,908 P171S probably benign Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vangl1 A G 3: 102,166,937 Y285H probably damaging Het
Virma A G 4: 11,498,769 D70G probably damaging Het
Vmn2r102 T C 17: 19,678,015 F431L probably benign Het
Wdr17 A G 8: 54,661,495 I662T probably damaging Het
Wisp2 G A 2: 163,825,313 C78Y probably damaging Het
Zfp160 G A 17: 21,027,006 R606H probably benign Het
Zfp369 C T 13: 65,296,434 R464C probably damaging Het
Other mutations in Olfr495
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Olfr495 APN 7 108395245 missense probably benign 0.31
IGL02430:Olfr495 APN 7 108395722 missense probably benign 0.01
IGL02511:Olfr495 APN 7 108396058 missense probably benign 0.06
IGL02932:Olfr495 APN 7 108395513 missense probably benign 0.03
IGL03222:Olfr495 APN 7 108395186 missense possibly damaging 0.77
FR4340:Olfr495 UTSW 7 108395893 missense probably benign
FR4340:Olfr495 UTSW 7 108395898 missense probably benign
FR4342:Olfr495 UTSW 7 108395893 missense probably benign
FR4342:Olfr495 UTSW 7 108395898 missense probably benign
R0141:Olfr495 UTSW 7 108395368 missense probably benign 0.06
R0635:Olfr495 UTSW 7 108395764 missense probably benign 0.01
R0685:Olfr495 UTSW 7 108395263 missense possibly damaging 0.67
R1220:Olfr495 UTSW 7 108395332 missense probably benign 0.03
R1398:Olfr495 UTSW 7 108395501 missense probably damaging 0.98
R1501:Olfr495 UTSW 7 108396082 missense probably benign 0.00
R1990:Olfr495 UTSW 7 108395834 missense probably benign 0.00
R2091:Olfr495 UTSW 7 108395861 missense probably damaging 1.00
R2473:Olfr495 UTSW 7 108395504 missense probably damaging 1.00
R3120:Olfr495 UTSW 7 108395723 missense possibly damaging 0.67
R4771:Olfr495 UTSW 7 108396022 nonsense probably null
R5240:Olfr495 UTSW 7 108395702 missense probably damaging 0.99
R5510:Olfr495 UTSW 7 108395125 missense probably benign 0.01
R5703:Olfr495 UTSW 7 108395500 missense probably benign 0.23
R6102:Olfr495 UTSW 7 108395284 missense probably damaging 0.99
R6110:Olfr495 UTSW 7 108395828 missense possibly damaging 0.93
R6782:Olfr495 UTSW 7 108395537 missense probably damaging 1.00
R7062:Olfr495 UTSW 7 108395830 nonsense probably null
R7783:Olfr495 UTSW 7 108396089 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CCAAGCTATCTTACTGGGCCAAGTC -3'
(R):5'- AGAAGGAAGCACTCAACTGTCGC -3'

Sequencing Primer
(F):5'- GCTCTCCATGCCCCAATTAAATG -3'
(R):5'- CTGTCGCAAGGAAAACAGC -3'
Posted On2013-07-11