Incidental Mutation 'R7136:Olfr1356'
ID553083
Institutional Source Beutler Lab
Gene Symbol Olfr1356
Ensembl Gene ENSMUSG00000051190
Gene Nameolfactory receptor 1356
SynonymsMOR142-1, MOR142-2_p, GA_x6K02T2QGN0-2962025-2962987
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.117) question?
Stock #R7136 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location78845052-78852166 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78847781 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 45 (I45V)
Ref Sequence ENSEMBL: ENSMUSP00000144815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061289] [ENSMUST00000205100]
Predicted Effect probably benign
Transcript: ENSMUST00000061289
AA Change: I45V

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000054345
Gene: ENSMUSG00000051190
AA Change: I45V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205100
AA Change: I45V

PolyPhen 2 Score 0.431 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000144815
Gene: ENSMUSG00000051190
AA Change: I45V

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.6e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 305 1.4e-5 PFAM
Pfam:7tm_1 41 290 6.5e-22 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,466,631 D63E possibly damaging Het
1700123K08Rik A G 5: 138,562,348 S262P probably damaging Het
Abcc2 A G 19: 43,837,460 E1512G probably damaging Het
Abcg2 T G 6: 58,684,340 Y459D possibly damaging Het
Amy1 T C 3: 113,563,599 Y197C probably damaging Het
Bptf A G 11: 107,099,715 I516T probably damaging Het
Capn12 T A 7: 28,883,107 probably null Het
Cbln2 T A 18: 86,716,672 L190Q probably damaging Het
Ccdc157 C T 11: 4,148,592 E305K possibly damaging Het
Ccdc47 A G 11: 106,205,004 S289P probably benign Het
Chd3 C T 11: 69,348,438 E1756K probably null Het
Chrd G T 16: 20,734,522 A183S possibly damaging Het
Cp C T 3: 19,985,658 R880* probably null Het
Cyp24a1 A T 2: 170,494,143 D191E probably benign Het
Dnah1 T C 14: 31,298,656 Y1252C probably damaging Het
Eps8l1 A G 7: 4,477,404 D487G probably damaging Het
Fam227b T G 2: 126,124,028 Q159P probably damaging Het
Fat3 A G 9: 16,378,185 I14T probably benign Het
Fbxl19 C A 7: 127,750,045 T129N possibly damaging Het
Fuca2 T C 10: 13,505,921 F193L probably benign Het
Gm10037 A G 13: 67,842,992 probably null Het
H2-Q1 T C 17: 35,320,627 probably null Het
Hgh1 A G 15: 76,370,431 M336V probably benign Het
Il12b T C 11: 44,408,030 L104P probably benign Het
Kcnh2 A T 5: 24,332,991 F125I probably benign Het
Kcnk7 A G 19: 5,706,076 H110R probably benign Het
Kdm3a G A 6: 71,611,780 P415L probably benign Het
Kifc3 T C 8: 95,103,449 T610A probably benign Het
Lmbr1l C A 15: 98,911,491 probably null Het
Lmo7 T A 14: 101,920,539 M1436K unknown Het
Lrp1 C T 10: 127,558,622 C2574Y probably damaging Het
Med13l A G 5: 118,721,522 E258G possibly damaging Het
Mesp1 T C 7: 79,793,158 I124V probably damaging Het
Mrgpra2a A T 7: 47,427,186 I108N probably benign Het
Nos1 G T 5: 117,895,860 R349L possibly damaging Het
Olfr195 C T 16: 59,148,964 T38I probably damaging Het
Osgin1 T A 8: 119,441,437 M1K probably null Het
Pde4dip C T 3: 97,694,063 S2346N probably benign Het
Pde7a T C 3: 19,231,094 M310V probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pink1 T C 4: 138,317,458 T323A probably damaging Het
Polr3a C T 14: 24,461,815 R891Q probably damaging Het
Prkar1b C A 5: 139,108,608 C75F probably benign Het
Prss58 C T 6: 40,900,053 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Qars T C 9: 108,512,772 I350T probably damaging Het
Qprt T C 7: 127,108,812 K149R probably damaging Het
Rasgrf1 T A 9: 89,991,598 D653E probably damaging Het
Rbm26 T C 14: 105,144,267 M481V possibly damaging Het
Rdx C T 9: 52,086,445 T573M probably damaging Het
Rgs14 A G 13: 55,379,695 probably null Het
Robo2 T C 16: 73,956,550 E813G probably damaging Het
Rrbp1 A T 2: 143,949,680 F1369I probably benign Het
Sh2d4b T A 14: 40,840,252 T319S probably benign Het
Slc7a15 G T 12: 8,538,895 N217K probably damaging Het
Stmn1 A G 4: 134,470,777 K42E probably damaging Het
Tbl2 T G 5: 135,149,828 W31G probably benign Het
Tmem8b T C 4: 43,669,845 C114R possibly damaging Het
Tsc2 T C 17: 24,613,280 S711G probably benign Het
Ttn T C 2: 76,836,560 R11531G unknown Het
Ube2e3 T C 2: 78,913,741 Y105H probably benign Het
Usp16 G T 16: 87,483,171 C753F probably benign Het
Vmn1r13 T C 6: 57,210,254 S133P possibly damaging Het
Vmn2r76 T A 7: 86,228,767 Q474L probably benign Het
Vps52 T C 17: 33,965,288 I601T probably benign Het
Wasf1 A T 10: 40,926,591 T81S possibly damaging Het
Wdr82 A G 9: 106,171,333 S39G probably benign Het
Zdhhc13 A G 7: 48,801,332 I108V probably benign Het
Other mutations in Olfr1356
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Olfr1356 APN 10 78847763 missense probably damaging 1.00
IGL01343:Olfr1356 APN 10 78847597 missense probably damaging 0.97
IGL01576:Olfr1356 APN 10 78847373 missense possibly damaging 0.94
IGL02314:Olfr1356 APN 10 78847265 missense probably damaging 1.00
IGL02474:Olfr1356 APN 10 78847063 missense probably damaging 1.00
IGL02960:Olfr1356 APN 10 78847537 missense probably damaging 1.00
IGL03049:Olfr1356 APN 10 78847522 missense possibly damaging 0.81
IGL03328:Olfr1356 APN 10 78847367 missense probably benign 0.39
R1602:Olfr1356 UTSW 10 78846968 missense probably benign
R1722:Olfr1356 UTSW 10 78846971 missense probably benign
R2178:Olfr1356 UTSW 10 78847778 missense probably damaging 0.96
R3903:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R3904:Olfr1356 UTSW 10 78847298 missense probably benign 0.00
R4241:Olfr1356 UTSW 10 78847905 missense probably benign 0.00
R4833:Olfr1356 UTSW 10 78847575 missense probably damaging 1.00
R5465:Olfr1356 UTSW 10 78847018 missense probably benign 0.00
R5527:Olfr1356 UTSW 10 78847775 missense probably benign 0.02
R5606:Olfr1356 UTSW 10 78847561 missense probably benign 0.19
R5977:Olfr1356 UTSW 10 78847738 missense possibly damaging 0.95
R6219:Olfr1356 UTSW 10 78847259 missense possibly damaging 0.88
R6996:Olfr1356 UTSW 10 78847517 missense probably benign 0.00
R7782:Olfr1356 UTSW 10 78847613 missense probably benign 0.01
R7996:Olfr1356 UTSW 10 78847321 missense probably damaging 1.00
Z1176:Olfr1356 UTSW 10 78847021 missense possibly damaging 0.73
Z1177:Olfr1356 UTSW 10 78847456 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTCCAGGCATCCAAACAC -3'
(R):5'- CAGGATCCACTTGAGATGAATTTG -3'

Sequencing Primer
(F):5'- ATTCTGCAGAACCTTGGG -3'
(R):5'- ATCCACTTGAGATGAATTTGTGCTG -3'
Posted On2019-05-15