Incidental Mutation 'R7136:Polr3a'
ID553092
Institutional Source Beutler Lab
Gene Symbol Polr3a
Ensembl Gene ENSMUSG00000025280
Gene Namepolymerase (RNA) III (DNA directed) polypeptide A
SynonymsRPC1, 9330175N20Rik, RPC155
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7136 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location24448696-24487058 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 24461815 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 891 (R891Q)
Ref Sequence ENSEMBL: ENSMUSP00000026322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000223718]
Predicted Effect probably damaging
Transcript: ENSMUST00000026322
AA Change: R891Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280
AA Change: R891Q

DomainStartEndE-ValueType
Blast:RPOLA_N 122 218 5e-43 BLAST
RPOLA_N 248 553 1.09e-176 SMART
Pfam:RNA_pol_Rpb1_4 728 834 4e-35 PFAM
Pfam:RNA_pol_Rpb1_5 841 1318 1.2e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223718
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the catalytic component of RNA polymerase III, which synthesizes small RNAs. The encoded protein also acts as a sensor to detect foreign DNA and trigger an innate immune response. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,466,631 D63E possibly damaging Het
1700123K08Rik A G 5: 138,562,348 S262P probably damaging Het
Abcc2 A G 19: 43,837,460 E1512G probably damaging Het
Abcg2 T G 6: 58,684,340 Y459D possibly damaging Het
Amy1 T C 3: 113,563,599 Y197C probably damaging Het
Bptf A G 11: 107,099,715 I516T probably damaging Het
Capn12 T A 7: 28,883,107 probably null Het
Cbln2 T A 18: 86,716,672 L190Q probably damaging Het
Ccdc157 C T 11: 4,148,592 E305K possibly damaging Het
Ccdc47 A G 11: 106,205,004 S289P probably benign Het
Chd3 C T 11: 69,348,438 E1756K probably null Het
Chrd G T 16: 20,734,522 A183S possibly damaging Het
Cp C T 3: 19,985,658 R880* probably null Het
Cyp24a1 A T 2: 170,494,143 D191E probably benign Het
Dnah1 T C 14: 31,298,656 Y1252C probably damaging Het
Eps8l1 A G 7: 4,477,404 D487G probably damaging Het
Fam227b T G 2: 126,124,028 Q159P probably damaging Het
Fat3 A G 9: 16,378,185 I14T probably benign Het
Fbxl19 C A 7: 127,750,045 T129N possibly damaging Het
Fuca2 T C 10: 13,505,921 F193L probably benign Het
Gm10037 A G 13: 67,842,992 probably null Het
H2-Q1 T C 17: 35,320,627 probably null Het
Hgh1 A G 15: 76,370,431 M336V probably benign Het
Il12b T C 11: 44,408,030 L104P probably benign Het
Kcnh2 A T 5: 24,332,991 F125I probably benign Het
Kcnk7 A G 19: 5,706,076 H110R probably benign Het
Kdm3a G A 6: 71,611,780 P415L probably benign Het
Kifc3 T C 8: 95,103,449 T610A probably benign Het
Lmbr1l C A 15: 98,911,491 probably null Het
Lmo7 T A 14: 101,920,539 M1436K unknown Het
Lrp1 C T 10: 127,558,622 C2574Y probably damaging Het
Med13l A G 5: 118,721,522 E258G possibly damaging Het
Mesp1 T C 7: 79,793,158 I124V probably damaging Het
Mrgpra2a A T 7: 47,427,186 I108N probably benign Het
Nos1 G T 5: 117,895,860 R349L possibly damaging Het
Olfr1356 T C 10: 78,847,781 I45V probably benign Het
Olfr195 C T 16: 59,148,964 T38I probably damaging Het
Osgin1 T A 8: 119,441,437 M1K probably null Het
Pde4dip C T 3: 97,694,063 S2346N probably benign Het
Pde7a T C 3: 19,231,094 M310V probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pink1 T C 4: 138,317,458 T323A probably damaging Het
Prkar1b C A 5: 139,108,608 C75F probably benign Het
Prss58 C T 6: 40,900,053 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Qars T C 9: 108,512,772 I350T probably damaging Het
Qprt T C 7: 127,108,812 K149R probably damaging Het
Rasgrf1 T A 9: 89,991,598 D653E probably damaging Het
Rbm26 T C 14: 105,144,267 M481V possibly damaging Het
Rdx C T 9: 52,086,445 T573M probably damaging Het
Rgs14 A G 13: 55,379,695 probably null Het
Robo2 T C 16: 73,956,550 E813G probably damaging Het
Rrbp1 A T 2: 143,949,680 F1369I probably benign Het
Sh2d4b T A 14: 40,840,252 T319S probably benign Het
Slc7a15 G T 12: 8,538,895 N217K probably damaging Het
Stmn1 A G 4: 134,470,777 K42E probably damaging Het
Tbl2 T G 5: 135,149,828 W31G probably benign Het
Tmem8b T C 4: 43,669,845 C114R possibly damaging Het
Tsc2 T C 17: 24,613,280 S711G probably benign Het
Ttn T C 2: 76,836,560 R11531G unknown Het
Ube2e3 T C 2: 78,913,741 Y105H probably benign Het
Usp16 G T 16: 87,483,171 C753F probably benign Het
Vmn1r13 T C 6: 57,210,254 S133P possibly damaging Het
Vmn2r76 T A 7: 86,228,767 Q474L probably benign Het
Vps52 T C 17: 33,965,288 I601T probably benign Het
Wasf1 A T 10: 40,926,591 T81S possibly damaging Het
Wdr82 A G 9: 106,171,333 S39G probably benign Het
Zdhhc13 A G 7: 48,801,332 I108V probably benign Het
Other mutations in Polr3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Polr3a APN 14 24475863 missense probably benign 0.35
IGL00974:Polr3a APN 14 24479424 missense probably benign 0.05
IGL01348:Polr3a APN 14 24461763 missense probably damaging 1.00
IGL01464:Polr3a APN 14 24470681 splice site probably benign
IGL01785:Polr3a APN 14 24484120 nonsense probably null
IGL01786:Polr3a APN 14 24484120 nonsense probably null
IGL01936:Polr3a APN 14 24479188 missense probably damaging 1.00
IGL02095:Polr3a APN 14 24454610 missense possibly damaging 0.91
IGL02454:Polr3a APN 14 24475823 missense possibly damaging 0.87
IGL02702:Polr3a APN 14 24470877 missense probably benign 0.07
IGL02961:Polr3a APN 14 24467040 nonsense probably null
IGL03069:Polr3a APN 14 24461740 missense probably damaging 0.99
R0001:Polr3a UTSW 14 24452189 splice site probably benign
R0048:Polr3a UTSW 14 24469255 splice site probably benign
R0157:Polr3a UTSW 14 24479186 missense probably damaging 0.99
R0445:Polr3a UTSW 14 24454921 missense probably benign 0.00
R0449:Polr3a UTSW 14 24484466 missense probably damaging 0.99
R0597:Polr3a UTSW 14 24484134 missense probably benign 0.29
R0604:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0644:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0703:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0754:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0767:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0816:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0817:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0819:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R0840:Polr3a UTSW 14 24452200 missense possibly damaging 0.95
R1481:Polr3a UTSW 14 24452548 missense probably null 0.98
R1644:Polr3a UTSW 14 24470624 missense probably damaging 1.00
R1699:Polr3a UTSW 14 24484164 missense probably damaging 1.00
R1704:Polr3a UTSW 14 24484120 nonsense probably null
R2363:Polr3a UTSW 14 24475892 splice site probably null
R3419:Polr3a UTSW 14 24467035 missense probably damaging 1.00
R3934:Polr3a UTSW 14 24476101 missense probably benign 0.30
R4296:Polr3a UTSW 14 24453196 missense possibly damaging 0.82
R4611:Polr3a UTSW 14 24452508 splice site probably null
R4690:Polr3a UTSW 14 24464281 missense possibly damaging 0.78
R4934:Polr3a UTSW 14 24452624 missense probably benign 0.11
R4947:Polr3a UTSW 14 24482464 missense probably benign 0.00
R5232:Polr3a UTSW 14 24453211 missense probably benign 0.00
R5263:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5264:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5265:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5282:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5319:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5321:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5323:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5387:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5388:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5401:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5402:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5443:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5444:Polr3a UTSW 14 24454941 missense possibly damaging 0.65
R5725:Polr3a UTSW 14 24465387 splice site probably null
R5841:Polr3a UTSW 14 24450698 missense probably benign 0.00
R6408:Polr3a UTSW 14 24486871 critical splice donor site probably null
R6704:Polr3a UTSW 14 24461842 missense probably damaging 1.00
R7307:Polr3a UTSW 14 24459987 missense probably benign 0.03
R7368:Polr3a UTSW 14 24467076 missense probably damaging 0.98
R7800:Polr3a UTSW 14 24484387 missense probably null 0.83
Z1088:Polr3a UTSW 14 24479724 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGCCAAGAGAAGACAGAGCCTC -3'
(R):5'- GGAGGCAGCTATAAGGGTTTC -3'

Sequencing Primer
(F):5'- GACAGAGCCTCCAGAAGTCTG -3'
(R):5'- ATTCGAGTGCTTATAACCCAGGGC -3'
Posted On2019-05-15