Incidental Mutation 'R7136:Olfr195'
ID553100
Institutional Source Beutler Lab
Gene Symbol Olfr195
Ensembl Gene ENSMUSG00000062608
Gene Nameolfactory receptor 195
SynonymsMOR184-5, GA_x54KRFPKG5P-55369823-55370749
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R7136 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location59147046-59150777 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59148964 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 38 (T38I)
Ref Sequence ENSEMBL: ENSMUSP00000150249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075381] [ENSMUST00000216957]
Predicted Effect probably damaging
Transcript: ENSMUST00000075381
AA Change: T38I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073737
Gene: ENSMUSG00000062608
AA Change: T38I

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 4.1e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 161 2.7e-8 PFAM
Pfam:7tm_1 41 307 9.4e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216957
AA Change: T38I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700015F17Rik A T 5: 5,466,631 D63E possibly damaging Het
1700123K08Rik A G 5: 138,562,348 S262P probably damaging Het
Abcc2 A G 19: 43,837,460 E1512G probably damaging Het
Abcg2 T G 6: 58,684,340 Y459D possibly damaging Het
Amy1 T C 3: 113,563,599 Y197C probably damaging Het
Bptf A G 11: 107,099,715 I516T probably damaging Het
Capn12 T A 7: 28,883,107 probably null Het
Cbln2 T A 18: 86,716,672 L190Q probably damaging Het
Ccdc157 C T 11: 4,148,592 E305K possibly damaging Het
Ccdc47 A G 11: 106,205,004 S289P probably benign Het
Chd3 C T 11: 69,348,438 E1756K probably null Het
Chrd G T 16: 20,734,522 A183S possibly damaging Het
Cp C T 3: 19,985,658 R880* probably null Het
Cyp24a1 A T 2: 170,494,143 D191E probably benign Het
Dnah1 T C 14: 31,298,656 Y1252C probably damaging Het
Eps8l1 A G 7: 4,477,404 D487G probably damaging Het
Fam227b T G 2: 126,124,028 Q159P probably damaging Het
Fat3 A G 9: 16,378,185 I14T probably benign Het
Fbxl19 C A 7: 127,750,045 T129N possibly damaging Het
Fuca2 T C 10: 13,505,921 F193L probably benign Het
Gm10037 A G 13: 67,842,992 probably null Het
H2-Q1 T C 17: 35,320,627 probably null Het
Hgh1 A G 15: 76,370,431 M336V probably benign Het
Il12b T C 11: 44,408,030 L104P probably benign Het
Kcnh2 A T 5: 24,332,991 F125I probably benign Het
Kcnk7 A G 19: 5,706,076 H110R probably benign Het
Kdm3a G A 6: 71,611,780 P415L probably benign Het
Kifc3 T C 8: 95,103,449 T610A probably benign Het
Lmbr1l C A 15: 98,911,491 probably null Het
Lmo7 T A 14: 101,920,539 M1436K unknown Het
Lrp1 C T 10: 127,558,622 C2574Y probably damaging Het
Med13l A G 5: 118,721,522 E258G possibly damaging Het
Mesp1 T C 7: 79,793,158 I124V probably damaging Het
Mrgpra2a A T 7: 47,427,186 I108N probably benign Het
Nos1 G T 5: 117,895,860 R349L possibly damaging Het
Olfr1356 T C 10: 78,847,781 I45V probably benign Het
Osgin1 T A 8: 119,441,437 M1K probably null Het
Pde4dip C T 3: 97,694,063 S2346N probably benign Het
Pde7a T C 3: 19,231,094 M310V probably benign Het
Pigw G A 11: 84,877,759 T248M probably damaging Het
Pink1 T C 4: 138,317,458 T323A probably damaging Het
Polr3a C T 14: 24,461,815 R891Q probably damaging Het
Prkar1b C A 5: 139,108,608 C75F probably benign Het
Prss58 C T 6: 40,900,053 probably null Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Qars T C 9: 108,512,772 I350T probably damaging Het
Qprt T C 7: 127,108,812 K149R probably damaging Het
Rasgrf1 T A 9: 89,991,598 D653E probably damaging Het
Rbm26 T C 14: 105,144,267 M481V possibly damaging Het
Rdx C T 9: 52,086,445 T573M probably damaging Het
Rgs14 A G 13: 55,379,695 probably null Het
Robo2 T C 16: 73,956,550 E813G probably damaging Het
Rrbp1 A T 2: 143,949,680 F1369I probably benign Het
Sh2d4b T A 14: 40,840,252 T319S probably benign Het
Slc7a15 G T 12: 8,538,895 N217K probably damaging Het
Stmn1 A G 4: 134,470,777 K42E probably damaging Het
Tbl2 T G 5: 135,149,828 W31G probably benign Het
Tmem8b T C 4: 43,669,845 C114R possibly damaging Het
Tsc2 T C 17: 24,613,280 S711G probably benign Het
Ttn T C 2: 76,836,560 R11531G unknown Het
Ube2e3 T C 2: 78,913,741 Y105H probably benign Het
Usp16 G T 16: 87,483,171 C753F probably benign Het
Vmn1r13 T C 6: 57,210,254 S133P possibly damaging Het
Vmn2r76 T A 7: 86,228,767 Q474L probably benign Het
Vps52 T C 17: 33,965,288 I601T probably benign Het
Wasf1 A T 10: 40,926,591 T81S possibly damaging Het
Wdr82 A G 9: 106,171,333 S39G probably benign Het
Zdhhc13 A G 7: 48,801,332 I108V probably benign Het
Other mutations in Olfr195
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Olfr195 APN 16 59149464 missense probably benign 0.01
IGL01945:Olfr195 APN 16 59149464 missense probably benign 0.01
R0071:Olfr195 UTSW 16 59149215 missense probably benign 0.23
R0390:Olfr195 UTSW 16 59149299 missense probably benign 0.01
R0601:Olfr195 UTSW 16 59149754 missense probably benign 0.00
R1499:Olfr195 UTSW 16 59148924 missense probably benign
R1612:Olfr195 UTSW 16 59149624 missense probably benign 0.00
R1785:Olfr195 UTSW 16 59149297 missense probably damaging 1.00
R2082:Olfr195 UTSW 16 59148885 missense probably damaging 0.99
R3605:Olfr195 UTSW 16 59149483 missense probably damaging 1.00
R4168:Olfr195 UTSW 16 59149000 missense probably benign 0.00
R4839:Olfr195 UTSW 16 59149030 missense probably damaging 1.00
R4989:Olfr195 UTSW 16 59149618 missense probably damaging 1.00
R5285:Olfr195 UTSW 16 59149270 missense probably damaging 1.00
R7107:Olfr195 UTSW 16 59148916 missense probably benign 0.10
R7317:Olfr195 UTSW 16 59149321 missense possibly damaging 0.80
R7601:Olfr195 UTSW 16 59149234 missense probably benign 0.01
R7729:Olfr195 UTSW 16 59149207 missense probably damaging 1.00
R8004:Olfr195 UTSW 16 59148988 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTAGAGAAAACAGCAGGTGC -3'
(R):5'- GAGAGAAATCCTTCTGTCCACAG -3'

Sequencing Primer
(F):5'- GTGCAGTGAGAAGAAAATTTCCTC -3'
(R):5'- GAAAAGAAGTTCTCTAGCATCTTCGG -3'
Posted On2019-05-15