Incidental Mutation 'R7137:Tor1aip2'
ID553110
Institutional Source Beutler Lab
Gene Symbol Tor1aip2
Ensembl Gene ENSMUSG00000050565
Gene Nametorsin A interacting protein 2
Synonyms15kDa, Ifrg15, LULL1, 1110020D10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location156035403-156068861 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 156051976 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 33 (N33K)
Ref Sequence ENSEMBL: ENSMUSP00000107383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060404] [ENSMUST00000065648] [ENSMUST00000097526] [ENSMUST00000111754] [ENSMUST00000111757] [ENSMUST00000128941] [ENSMUST00000133152]
Predicted Effect probably benign
Transcript: ENSMUST00000060404
SMART Domains Protein: ENSMUSP00000050817
Gene: ENSMUSG00000050565

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-222 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000065648
AA Change: N33K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000097526
AA Change: N33K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000111754
AA Change: N33K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000111757
SMART Domains Protein: ENSMUSP00000107387
Gene: ENSMUSG00000050565

DomainStartEndE-ValueType
Pfam:LAP1C 26 501 3.9e-169 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000128941
AA Change: N33K

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000133152
Meta Mutation Damage Score 0.1121 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Tor1aip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01812:Tor1aip2 APN 1 156059539 missense probably benign 0.05
IGL02175:Tor1aip2 APN 1 156065006 missense probably damaging 0.96
IGL02328:Tor1aip2 APN 1 156064974 missense probably damaging 0.98
R0143:Tor1aip2 UTSW 1 156059548 missense probably benign 0.06
R1037:Tor1aip2 UTSW 1 156065336 missense probably benign 0.00
R1146:Tor1aip2 UTSW 1 156064737 missense possibly damaging 0.51
R1146:Tor1aip2 UTSW 1 156064737 missense possibly damaging 0.51
R1694:Tor1aip2 UTSW 1 156065285 missense probably benign
R1922:Tor1aip2 UTSW 1 156064794 missense probably damaging 1.00
R1955:Tor1aip2 UTSW 1 156051842 intron probably benign
R2131:Tor1aip2 UTSW 1 156065349 missense probably damaging 0.97
R3758:Tor1aip2 UTSW 1 156065289 missense probably damaging 0.98
R4243:Tor1aip2 UTSW 1 156065436 missense probably damaging 0.98
R4583:Tor1aip2 UTSW 1 156065142 missense probably benign 0.01
R4678:Tor1aip2 UTSW 1 156065034 missense probably damaging 0.99
R5564:Tor1aip2 UTSW 1 156063561 unclassified probably benign
R6316:Tor1aip2 UTSW 1 156062094 missense probably damaging 0.99
R6713:Tor1aip2 UTSW 1 156065409 missense probably damaging 0.99
R6892:Tor1aip2 UTSW 1 156065181 missense possibly damaging 0.95
R8137:Tor1aip2 UTSW 1 156063668 missense possibly damaging 0.93
Z1176:Tor1aip2 UTSW 1 156052189 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GTTGCTAAAGGAAACTGTAACTGG -3'
(R):5'- TTCTAACCAGTGGAGGACCC -3'

Sequencing Primer
(F):5'- GAAACTGTAACTGGACTGACTGTTGC -3'
(R):5'- CCCAGAAGAAATGGATGGCAAGC -3'
Posted On2019-05-15