Incidental Mutation 'R7137:Acvr1c'
ID553112
Institutional Source Beutler Lab
Gene Symbol Acvr1c
Ensembl Gene ENSMUSG00000026834
Gene Nameactivin A receptor, type IC
SynonymsALK7, Alk-7
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location58267453-58357895 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 58283387 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000028178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028178] [ENSMUST00000100085] [ENSMUST00000112607] [ENSMUST00000112608]
Predicted Effect probably null
Transcript: ENSMUST00000028178
SMART Domains Protein: ENSMUSP00000028178
Gene: ENSMUSG00000026834

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.1e-13 PFAM
transmembrane domain 114 136 N/A INTRINSIC
GS 165 195 1.07e-13 SMART
Blast:TyrKc 201 472 3e-28 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000100085
SMART Domains Protein: ENSMUSP00000097663
Gene: ENSMUSG00000026834

DomainStartEndE-ValueType
Pfam:Activin_recp 1 50 1.1e-7 PFAM
Pfam:TGF_beta_GS 51 63 2.6e-7 PFAM
Pfam:Pkinase 65 352 5.6e-51 PFAM
Pfam:Pkinase_Tyr 65 352 4e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112607
SMART Domains Protein: ENSMUSP00000108226
Gene: ENSMUSG00000026834

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 3.5e-15 PFAM
Pfam:Pkinase 51 325 9.5e-37 PFAM
Pfam:Pkinase_Tyr 92 325 4.8e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000112608
SMART Domains Protein: ENSMUSP00000108227
Gene: ENSMUSG00000026834

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:Activin_recp 26 100 4.9e-15 PFAM
Pfam:TGF_beta_GS 101 113 1.2e-8 PFAM
Pfam:Pkinase 115 402 2.3e-51 PFAM
Pfam:Pkinase_Tyr 115 402 1.6e-34 PFAM
Meta Mutation Damage Score 0.9483 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal with no apparent left-right patterning abnormalities or organogenesis defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Acvr1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Acvr1c APN 2 58315855 missense probably damaging 1.00
IGL00543:Acvr1c APN 2 58315823 missense probably damaging 1.00
IGL01287:Acvr1c APN 2 58280242 nonsense probably null
IGL01313:Acvr1c APN 2 58315974 missense probably benign 0.10
IGL01722:Acvr1c APN 2 58283549 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0035:Acvr1c UTSW 2 58315779 splice site probably benign
R0329:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R0330:Acvr1c UTSW 2 58284838 missense probably damaging 0.96
R1311:Acvr1c UTSW 2 58280249 missense probably benign 0.04
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1465:Acvr1c UTSW 2 58284961 missense probably damaging 1.00
R1511:Acvr1c UTSW 2 58287884 missense probably damaging 1.00
R1813:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1896:Acvr1c UTSW 2 58280294 missense probably damaging 1.00
R1935:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1939:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R1940:Acvr1c UTSW 2 58283505 missense probably damaging 1.00
R2001:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R2002:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R2305:Acvr1c UTSW 2 58281699 missense probably damaging 1.00
R4786:Acvr1c UTSW 2 58280354 missense probably damaging 1.00
R4947:Acvr1c UTSW 2 58315975 missense probably benign 0.04
R5121:Acvr1c UTSW 2 58281650 missense probably damaging 1.00
R5133:Acvr1c UTSW 2 58283506 missense probably damaging 1.00
R5381:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5383:Acvr1c UTSW 2 58287735 missense probably damaging 1.00
R5647:Acvr1c UTSW 2 58295964 missense probably damaging 1.00
R5988:Acvr1c UTSW 2 58315874 missense probably damaging 1.00
R6860:Acvr1c UTSW 2 58287705 missense probably damaging 1.00
R7200:Acvr1c UTSW 2 58315855 missense probably damaging 1.00
R7278:Acvr1c UTSW 2 58284936 missense probably damaging 1.00
R8029:Acvr1c UTSW 2 58296117 missense possibly damaging 0.95
R8504:Acvr1c UTSW 2 58283479 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGGGCATGCCAATTGTCTC -3'
(R):5'- CTTATGCTTTATAGGTAAGCCTGC -3'

Sequencing Primer
(F):5'- AGATTCTGGCCCCAATTGG -3'
(R):5'- ATAGGTAAGCCTGCTATTGCTCAC -3'
Posted On2019-05-15