Mutagenetix > Incidental Mutations

Incidental Mutation 'R7137:Acvr1c'

553112

Institutional Source

Beutler Lab

Gene Symbol

Acvr1c

Ensembl Gene

ENSMUSG00000026834

Gene Name

activin A receptor, type IC

Synonyms

ALK7, Alk-7

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7137 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

58267453-58357895 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to G at 58283387 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028178 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028178] [ENSMUST00000100085] [ENSMUST00000112607] [ENSMUST00000112608]

Predicted Effect

probably null
Transcript: ENSMUST00000028178

SMART Domains

Protein: ENSMUSP00000028178
Gene: ENSMUSG00000026834

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Activin_recp	26	100	3.1e-13	PFAM
transmembrane domain	114	136	N/A	INTRINSIC
GS	165	195	1.07e-13	SMART
Blast:TyrKc	201	472	3e-28	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000100085

SMART Domains

Protein: ENSMUSP00000097663
Gene: ENSMUSG00000026834

Domain	Start	End	E-Value	Type
Pfam:Activin_recp	1	50	1.1e-7	PFAM
Pfam:TGF_beta_GS	51	63	2.6e-7	PFAM
Pfam:Pkinase	65	352	5.6e-51	PFAM
Pfam:Pkinase_Tyr	65	352	4e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000112607

SMART Domains

Protein: ENSMUSP00000108226
Gene: ENSMUSG00000026834

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Activin_recp	26	100	3.5e-15	PFAM
Pfam:Pkinase	51	325	9.5e-37	PFAM
Pfam:Pkinase_Tyr	92	325	4.8e-24	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000112608

SMART Domains

Protein: ENSMUSP00000108227
Gene: ENSMUSG00000026834

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
Pfam:Activin_recp	26	100	4.9e-15	PFAM
Pfam:TGF_beta_GS	101	113	1.2e-8	PFAM
Pfam:Pkinase	115	402	2.3e-51	PFAM
Pfam:Pkinase_Tyr	115	402	1.6e-34	PFAM

Meta Mutation Damage Score

0.9483

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ACVR1C is a type I receptor for the TGFB (see MIM 190180) family of signaling molecules. Upon ligand binding, type I receptors phosphorylate cytoplasmic SMAD transcription factors, which then translocate to the nucleus and interact directly with DNA or in complex with other transcription factors (Bondestam et al., 2001 [PubMed 12063393]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile, and overtly normal with no apparent left-right patterning abnormalities or organogenesis defects. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,677,985	S1423P	possibly damaging	Het
Adgrf5	A	G	17: 43,450,897	K1161R	probably damaging	Het
Arhgap32	T	G	9: 32,151,936	D80E	probably benign	Het
Aspg	T	C	12: 112,112,198	V30A	possibly damaging	Het
Bcl2a1d	T	C	9: 88,731,478	D81G	probably damaging	Het
Cep170b	T	C	12: 112,735,167	V160A	probably benign	Het
Ces1c	T	C	8: 93,130,842	Y37C	probably benign	Het
Cntnap5a	T	C	1: 116,089,376	L233P	probably damaging	Het
Crem	C	A	18: 3,273,459	A245S	possibly damaging	Het
Cyp2d12	C	T	15: 82,557,821	A280V	probably benign	Het
Dnah2	C	T	11: 69,491,555	G1243D	probably damaging	Het
Emcn	T	G	3: 137,403,991	N131K	probably damaging	Het
Fat3	A	T	9: 15,997,148	D2519E	probably damaging	Het
Fibin	T	A	2: 110,362,656	D47V	probably damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gimap8	C	A	6: 48,650,253	L54I	probably damaging	Het
Gm20481	A	G	17: 34,970,095	Y27C	unknown	Het
Gm21319	A	T	12: 87,773,546	L81Q	possibly damaging	Het
Grin1	T	G	2: 25,313,538	M154L	probably benign	Het
Ighv8-13	A	G	12: 115,765,577	L20P	probably damaging	Het
Insc	G	A	7: 114,811,615	V236I	probably benign	Het
Lrrk1	A	G	7: 66,285,279	F1031L	probably benign	Het
Man2a2	C	A	7: 80,359,751	R785L	probably benign	Het
Mcur1	C	A	13: 43,544,455		probably null	Het
Med12l	A	C	3: 59,258,254	R1464S	probably damaging	Het
Mycbp2	A	T	14: 103,282,679	M767K	possibly damaging	Het
Naalad2	T	C	9: 18,323,487	I762V	probably benign	Het
Nfkbid	A	G	7: 30,426,256	T357A	possibly damaging	Het
Pcdh17	A	G	14: 84,533,549	R1156G	possibly damaging	Het
Pcdhb1	T	C	18: 37,267,392	S799P	possibly damaging	Het
Pde3a	A	T	6: 141,498,746	E1093D	probably benign	Het
Plcg1	T	C	2: 160,753,926	Y572H	possibly damaging	Het
Plxna4	A	G	6: 32,517,264	L139P	probably damaging	Het
Psma1	A	G	7: 114,274,448	Y6H	probably damaging	Het
Psmd2	A	G	16: 20,652,627	E76G	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Pyy	T	G	11: 102,107,273	D27A	possibly damaging	Het
Slc22a2	A	G	17: 12,584,341	T21A	probably benign	Het
Slc25a2	T	C	18: 37,638,147	I110V	probably benign	Het
Sult1c2	A	C	17: 53,838,394	W85G	probably damaging	Het
Svs1	A	G	6: 48,990,149	Y677C	probably damaging	Het
Syt12	C	T	19: 4,453,950	D218N	probably damaging	Het
Tln1	C	T	4: 43,540,616	V1462M	probably damaging	Het
Tor1aip2	T	A	1: 156,051,976	N33K	possibly damaging	Het
Usp17lb	C	A	7: 104,841,591	W43L	probably benign	Het
Vmn1r76	A	G	7: 11,930,685	Y201H	possibly damaging	Het
Wnk1	C	A	6: 120,038,212		probably benign	Het
Wrnip1	A	G	13: 32,802,749	D171G	probably benign	Het
Zar1	T	A	5: 72,580,816	N81I	probably damaging	Het
Zbtb45	T	C	7: 13,007,156	T392A	probably benign	Het
Zfp445	T	C	9: 122,854,778	E272G	probably damaging	Het

Other mutations in Acvr1c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Acvr1c	APN	2	58315855	missense	probably damaging	1.00
IGL00543:Acvr1c	APN	2	58315823	missense	probably damaging	1.00
IGL01287:Acvr1c	APN	2	58280242	nonsense	probably null
IGL01313:Acvr1c	APN	2	58315974	missense	probably benign	0.10
IGL01722:Acvr1c	APN	2	58283549	splice site	probably benign
R0035:Acvr1c	UTSW	2	58315779	splice site	probably benign
R0035:Acvr1c	UTSW	2	58315779	splice site	probably benign
R0329:Acvr1c	UTSW	2	58284838	missense	probably damaging	0.96
R0330:Acvr1c	UTSW	2	58284838	missense	probably damaging	0.96
R1311:Acvr1c	UTSW	2	58280249	missense	probably benign	0.04
R1465:Acvr1c	UTSW	2	58284961	missense	probably damaging	1.00
R1465:Acvr1c	UTSW	2	58284961	missense	probably damaging	1.00
R1511:Acvr1c	UTSW	2	58287884	missense	probably damaging	1.00
R1813:Acvr1c	UTSW	2	58280294	missense	probably damaging	1.00
R1896:Acvr1c	UTSW	2	58280294	missense	probably damaging	1.00
R1935:Acvr1c	UTSW	2	58283505	missense	probably damaging	1.00
R1939:Acvr1c	UTSW	2	58283505	missense	probably damaging	1.00
R1940:Acvr1c	UTSW	2	58283505	missense	probably damaging	1.00
R2001:Acvr1c	UTSW	2	58315975	missense	probably benign	0.04
R2002:Acvr1c	UTSW	2	58315975	missense	probably benign	0.04
R2305:Acvr1c	UTSW	2	58281699	missense	probably damaging	1.00
R4786:Acvr1c	UTSW	2	58280354	missense	probably damaging	1.00
R4947:Acvr1c	UTSW	2	58315975	missense	probably benign	0.04
R5121:Acvr1c	UTSW	2	58281650	missense	probably damaging	1.00
R5133:Acvr1c	UTSW	2	58283506	missense	probably damaging	1.00
R5381:Acvr1c	UTSW	2	58287735	missense	probably damaging	1.00
R5383:Acvr1c	UTSW	2	58287735	missense	probably damaging	1.00
R5647:Acvr1c	UTSW	2	58295964	missense	probably damaging	1.00
R5988:Acvr1c	UTSW	2	58315874	missense	probably damaging	1.00
R6860:Acvr1c	UTSW	2	58287705	missense	probably damaging	1.00
R7200:Acvr1c	UTSW	2	58315855	missense	probably damaging	1.00
R7278:Acvr1c	UTSW	2	58284936	missense	probably damaging	1.00
R8029:Acvr1c	UTSW	2	58296117	missense	possibly damaging	0.95
R8504:Acvr1c	UTSW	2	58283479	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAGGGCATGCCAATTGTCTC -3'
(R):5'- CTTATGCTTTATAGGTAAGCCTGC -3'

Sequencing Primer
(F):5'- AGATTCTGGCCCCAATTGG -3'
(R):5'- ATAGGTAAGCCTGCTATTGCTCAC -3'

Posted On

2019-05-15