Mutagenetix > Incidental Mutations

Incidental Mutation 'R7137:Plcg1'

553114

Institutional Source

Beutler Lab

Gene Symbol

Plcg1

Ensembl Gene

ENSMUSG00000016933

Gene Name

phospholipase C, gamma 1

Synonyms

Cded, Plc-gamma1, Plcg-1, Plc-1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7137 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

160731300-160775760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 160753926 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 572 (Y572H)

Ref Sequence

ENSEMBL: ENSMUSP00000099404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000017077

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103115
AA Change: Y572H

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: Y572H

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109462
AA Change: Y572H

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: Y572H

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	240	318	5.2e-8	PFAM
PLCXc	320	464	3.7e-91	SMART
PH	489	680	2.99e1	SMART
SH2	548	645	1.12e-30	SMART
SH2	666	747	3.78e-28	SMART
SH3	794	850	6.49e-16	SMART
PH	804	933	8.93e-2	SMART
PLCYc	953	1070	3.23e-73	SMART
C2	1089	1192	1.37e-13	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124652

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129568

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133937

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147254

Predicted Effect

probably benign
Transcript: ENSMUST00000151590

SMART Domains

Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

Domain	Start	End	E-Value	Type
PH	33	144	5.54e-7	SMART
Pfam:EF-hand_like	239	318	4.4e-8	PFAM
PLCXc	320	464	3.7e-91	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154038

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173061

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173335

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173791

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,677,985	S1423P	possibly damaging	Het
Acvr1c	A	G	2: 58,283,387		probably null	Het
Adgrf5	A	G	17: 43,450,897	K1161R	probably damaging	Het
Arhgap32	T	G	9: 32,151,936	D80E	probably benign	Het
Aspg	T	C	12: 112,112,198	V30A	possibly damaging	Het
Bcl2a1d	T	C	9: 88,731,478	D81G	probably damaging	Het
Cep170b	T	C	12: 112,735,167	V160A	probably benign	Het
Ces1c	T	C	8: 93,130,842	Y37C	probably benign	Het
Cntnap5a	T	C	1: 116,089,376	L233P	probably damaging	Het
Crem	C	A	18: 3,273,459	A245S	possibly damaging	Het
Cyp2d12	C	T	15: 82,557,821	A280V	probably benign	Het
Dnah2	C	T	11: 69,491,555	G1243D	probably damaging	Het
Emcn	T	G	3: 137,403,991	N131K	probably damaging	Het
Fat3	A	T	9: 15,997,148	D2519E	probably damaging	Het
Fibin	T	A	2: 110,362,656	D47V	probably damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gimap8	C	A	6: 48,650,253	L54I	probably damaging	Het
Gm20481	A	G	17: 34,970,095	Y27C	unknown	Het
Gm21319	A	T	12: 87,773,546	L81Q	possibly damaging	Het
Grin1	T	G	2: 25,313,538	M154L	probably benign	Het
Ighv8-13	A	G	12: 115,765,577	L20P	probably damaging	Het
Insc	G	A	7: 114,811,615	V236I	probably benign	Het
Lrrk1	A	G	7: 66,285,279	F1031L	probably benign	Het
Man2a2	C	A	7: 80,359,751	R785L	probably benign	Het
Mcur1	C	A	13: 43,544,455		probably null	Het
Med12l	A	C	3: 59,258,254	R1464S	probably damaging	Het
Mycbp2	A	T	14: 103,282,679	M767K	possibly damaging	Het
Naalad2	T	C	9: 18,323,487	I762V	probably benign	Het
Nfkbid	A	G	7: 30,426,256	T357A	possibly damaging	Het
Pcdh17	A	G	14: 84,533,549	R1156G	possibly damaging	Het
Pcdhb1	T	C	18: 37,267,392	S799P	possibly damaging	Het
Pde3a	A	T	6: 141,498,746	E1093D	probably benign	Het
Plxna4	A	G	6: 32,517,264	L139P	probably damaging	Het
Psma1	A	G	7: 114,274,448	Y6H	probably damaging	Het
Psmd2	A	G	16: 20,652,627	E76G	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Pyy	T	G	11: 102,107,273	D27A	possibly damaging	Het
Slc22a2	A	G	17: 12,584,341	T21A	probably benign	Het
Slc25a2	T	C	18: 37,638,147	I110V	probably benign	Het
Sult1c2	A	C	17: 53,838,394	W85G	probably damaging	Het
Svs1	A	G	6: 48,990,149	Y677C	probably damaging	Het
Syt12	C	T	19: 4,453,950	D218N	probably damaging	Het
Tln1	C	T	4: 43,540,616	V1462M	probably damaging	Het
Tor1aip2	T	A	1: 156,051,976	N33K	possibly damaging	Het
Usp17lb	C	A	7: 104,841,591	W43L	probably benign	Het
Vmn1r76	A	G	7: 11,930,685	Y201H	possibly damaging	Het
Wnk1	C	A	6: 120,038,212		probably benign	Het
Wrnip1	A	G	13: 32,802,749	D171G	probably benign	Het
Zar1	T	A	5: 72,580,816	N81I	probably damaging	Het
Zbtb45	T	C	7: 13,007,156	T392A	probably benign	Het
Zfp445	T	C	9: 122,854,778	E272G	probably damaging	Het

Other mutations in Plcg1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Plcg1	APN	2	160757266	missense	probably damaging	1.00
IGL00885:Plcg1	APN	2	160758083	missense	probably benign	0.03
IGL01066:Plcg1	APN	2	160754398	missense	probably damaging	1.00
IGL01356:Plcg1	APN	2	160753893	missense	probably damaging	1.00
IGL01629:Plcg1	APN	2	160758010	missense	possibly damaging	0.69
IGL01732:Plcg1	APN	2	160747779	missense	probably damaging	0.97
IGL01754:Plcg1	APN	2	160761433	missense	probably damaging	1.00
IGL02195:Plcg1	APN	2	160753926	missense	possibly damaging	0.83
IGL02371:Plcg1	APN	2	160753507	missense	probably damaging	0.99
IGL02671:Plcg1	APN	2	160755752	nonsense	probably null
IGL03096:Plcg1	APN	2	160757206	splice site	probably benign
IGL03129:Plcg1	APN	2	160774526	critical splice acceptor site	probably null
IGL03139:Plcg1	APN	2	160748129	critical splice donor site	probably null
IGL03211:Plcg1	APN	2	160759691	missense	possibly damaging	0.82
suscepit	UTSW	2	160753602	splice site	probably null
IGL03047:Plcg1	UTSW	2	160754879	missense	probably damaging	1.00
R0098:Plcg1	UTSW	2	160732000	missense	probably damaging	1.00
R0390:Plcg1	UTSW	2	160752366	missense	probably damaging	1.00
R0413:Plcg1	UTSW	2	160761429	missense	probably damaging	1.00
R0650:Plcg1	UTSW	2	160753363	splice site	probably benign
R0679:Plcg1	UTSW	2	160756910	missense	probably damaging	1.00
R0709:Plcg1	UTSW	2	160751778	splice site	probably null
R1719:Plcg1	UTSW	2	160753743	missense	probably null	0.94
R1721:Plcg1	UTSW	2	160731920	missense	probably damaging	0.99
R1727:Plcg1	UTSW	2	160748088	missense	probably benign	0.00
R1978:Plcg1	UTSW	2	160752578	splice site	probably null
R2277:Plcg1	UTSW	2	160755805	missense	possibly damaging	0.48
R2698:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R3832:Plcg1	UTSW	2	160754437	missense	possibly damaging	0.95
R4094:Plcg1	UTSW	2	160747841	missense	probably damaging	0.98
R4260:Plcg1	UTSW	2	160751707	critical splice donor site	probably null
R4622:Plcg1	UTSW	2	160747768	splice site	probably benign
R4837:Plcg1	UTSW	2	160750986	missense	probably benign	0.00
R4942:Plcg1	UTSW	2	160753589	splice site	probably null
R5514:Plcg1	UTSW	2	160753355	critical splice donor site	probably null
R5647:Plcg1	UTSW	2	160751668	missense	probably benign	0.45
R5929:Plcg1	UTSW	2	160753602	splice site	probably null
R6303:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6304:Plcg1	UTSW	2	160761463	missense	possibly damaging	0.90
R6471:Plcg1	UTSW	2	160753710	missense	probably benign	0.10
R6500:Plcg1	UTSW	2	160754567	missense	probably damaging	1.00
R7017:Plcg1	UTSW	2	160758097	missense	probably damaging	1.00
R7113:Plcg1	UTSW	2	160748283	missense	possibly damaging	0.78
R7155:Plcg1	UTSW	2	160754380	missense	probably damaging	1.00
R7211:Plcg1	UTSW	2	160731874	missense	probably benign	0.02
R7777:Plcg1	UTSW	2	160754603	missense	possibly damaging	0.89
R7918:Plcg1	UTSW	2	160753665	missense	probably damaging	1.00
R7934:Plcg1	UTSW	2	160774578	missense	possibly damaging	0.53
R8309:Plcg1	UTSW	2	160753933	missense	probably benign	0.00
R8344:Plcg1	UTSW	2	160747896	missense	probably benign	0.00
R8377:Plcg1	UTSW	2	160754922	missense	probably damaging	1.00
R8524:Plcg1	UTSW	2	160761467	critical splice donor site	probably null
Z1176:Plcg1	UTSW	2	160758127	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TACTCTGAGGAGACCAGCAG -3'
(R):5'- TATGGAAAACCTAGACCCAAGG -3'

Sequencing Primer
(F):5'- CTGAGGAGACCAGCAGTGACC -3'
(R):5'- TAGACCCAAGGCTAAAATGTTAACC -3'

Posted On

2019-05-15