Incidental Mutation 'R7137:Plcg1'
ID553114
Institutional Source Beutler Lab
Gene Symbol Plcg1
Ensembl Gene ENSMUSG00000016933
Gene Namephospholipase C, gamma 1
SynonymsCded, Plc-gamma1, Plcg-1, Plc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location160731300-160775760 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 160753926 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 572 (Y572H)
Ref Sequence ENSEMBL: ENSMUSP00000099404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000017077
Predicted Effect possibly damaging
Transcript: ENSMUST00000103115
AA Change: Y572H

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: Y572H

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109462
AA Change: Y572H

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: Y572H

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129568
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133937
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147254
Predicted Effect probably benign
Transcript: ENSMUST00000151590
SMART Domains Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 239 318 4.4e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173061
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173335
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173791
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Plcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Plcg1 APN 2 160757266 missense probably damaging 1.00
IGL00885:Plcg1 APN 2 160758083 missense probably benign 0.03
IGL01066:Plcg1 APN 2 160754398 missense probably damaging 1.00
IGL01356:Plcg1 APN 2 160753893 missense probably damaging 1.00
IGL01629:Plcg1 APN 2 160758010 missense possibly damaging 0.69
IGL01732:Plcg1 APN 2 160747779 missense probably damaging 0.97
IGL01754:Plcg1 APN 2 160761433 missense probably damaging 1.00
IGL02195:Plcg1 APN 2 160753926 missense possibly damaging 0.83
IGL02371:Plcg1 APN 2 160753507 missense probably damaging 0.99
IGL02671:Plcg1 APN 2 160755752 nonsense probably null
IGL03096:Plcg1 APN 2 160757206 splice site probably benign
IGL03129:Plcg1 APN 2 160774526 critical splice acceptor site probably null
IGL03139:Plcg1 APN 2 160748129 critical splice donor site probably null
IGL03211:Plcg1 APN 2 160759691 missense possibly damaging 0.82
suscepit UTSW 2 160753602 splice site probably null
IGL03047:Plcg1 UTSW 2 160754879 missense probably damaging 1.00
R0098:Plcg1 UTSW 2 160732000 missense probably damaging 1.00
R0390:Plcg1 UTSW 2 160752366 missense probably damaging 1.00
R0413:Plcg1 UTSW 2 160761429 missense probably damaging 1.00
R0650:Plcg1 UTSW 2 160753363 splice site probably benign
R0679:Plcg1 UTSW 2 160756910 missense probably damaging 1.00
R0709:Plcg1 UTSW 2 160751778 splice site probably null
R1719:Plcg1 UTSW 2 160753743 missense probably null 0.94
R1721:Plcg1 UTSW 2 160731920 missense probably damaging 0.99
R1727:Plcg1 UTSW 2 160748088 missense probably benign 0.00
R1978:Plcg1 UTSW 2 160752578 splice site probably null
R2277:Plcg1 UTSW 2 160755805 missense possibly damaging 0.48
R2698:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R3832:Plcg1 UTSW 2 160754437 missense possibly damaging 0.95
R4094:Plcg1 UTSW 2 160747841 missense probably damaging 0.98
R4260:Plcg1 UTSW 2 160751707 critical splice donor site probably null
R4622:Plcg1 UTSW 2 160747768 splice site probably benign
R4837:Plcg1 UTSW 2 160750986 missense probably benign 0.00
R4942:Plcg1 UTSW 2 160753589 splice site probably null
R5514:Plcg1 UTSW 2 160753355 critical splice donor site probably null
R5647:Plcg1 UTSW 2 160751668 missense probably benign 0.45
R5929:Plcg1 UTSW 2 160753602 splice site probably null
R6303:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6304:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6471:Plcg1 UTSW 2 160753710 missense probably benign 0.10
R6500:Plcg1 UTSW 2 160754567 missense probably damaging 1.00
R7017:Plcg1 UTSW 2 160758097 missense probably damaging 1.00
R7113:Plcg1 UTSW 2 160748283 missense possibly damaging 0.78
R7155:Plcg1 UTSW 2 160754380 missense probably damaging 1.00
R7211:Plcg1 UTSW 2 160731874 missense probably benign 0.02
R7777:Plcg1 UTSW 2 160754603 missense possibly damaging 0.89
R7918:Plcg1 UTSW 2 160753665 missense probably damaging 1.00
R7934:Plcg1 UTSW 2 160774578 missense possibly damaging 0.53
R8309:Plcg1 UTSW 2 160753933 missense probably benign 0.00
R8344:Plcg1 UTSW 2 160747896 missense probably benign 0.00
R8377:Plcg1 UTSW 2 160754922 missense probably damaging 1.00
R8524:Plcg1 UTSW 2 160761467 critical splice donor site probably null
Z1176:Plcg1 UTSW 2 160758127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACTCTGAGGAGACCAGCAG -3'
(R):5'- TATGGAAAACCTAGACCCAAGG -3'

Sequencing Primer
(F):5'- CTGAGGAGACCAGCAGTGACC -3'
(R):5'- TAGACCCAAGGCTAAAATGTTAACC -3'
Posted On2019-05-15