Mutagenetix > Incidental Mutation

Incidental Mutation 'R7137:Pde3a'

553124

Institutional Source

Beutler Lab

Gene Symbol

Pde3a

Ensembl Gene

ENSMUSG00000041741

Gene Name

phosphodiesterase 3A, cGMP inhibited

Synonyms

A930022O17Rik

MMRRC Submission

045248-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.250) question?

Stock #

R7137 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

141249269-141507448 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 141498746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Aspartic acid at position 1093 (E1093D)

Ref Sequence

ENSEMBL: ENSMUSP00000038749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043259]

AlphaFold

Q9Z0X4

Predicted Effect

probably benign
Transcript: ENSMUST00000043259
AA Change: E1093D

PolyPhen 2 Score 0.259 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: E1093D

Domain	Start	End	E-Value	Type
low complexity region	29	43	N/A	INTRINSIC
transmembrane domain	60	82	N/A	INTRINSIC
low complexity region	93	102	N/A	INTRINSIC
low complexity region	103	121	N/A	INTRINSIC
transmembrane domain	126	148	N/A	INTRINSIC
transmembrane domain	155	177	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
transmembrane domain	230	252	N/A	INTRINSIC
low complexity region	419	445	N/A	INTRINSIC
low complexity region	520	544	N/A	INTRINSIC
HDc	749	964	3.76e-4	SMART
low complexity region	1028	1056	N/A	INTRINSIC
low complexity region	1114	1133	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,677,985	S1423P	possibly damaging	Het
Acvr1c	A	G	2: 58,283,387		probably null	Het
Adgrf5	A	G	17: 43,450,897	K1161R	probably damaging	Het
Arhgap32	T	G	9: 32,151,936	D80E	probably benign	Het
Aspg	T	C	12: 112,112,198	V30A	possibly damaging	Het
Bcl2a1d	T	C	9: 88,731,478	D81G	probably damaging	Het
Cep170b	T	C	12: 112,735,167	V160A	probably benign	Het
Ces1c	T	C	8: 93,130,842	Y37C	probably benign	Het
Cntnap5a	T	C	1: 116,089,376	L233P	probably damaging	Het
Crem	C	A	18: 3,273,459	A245S	possibly damaging	Het
Cyp2d12	C	T	15: 82,557,821	A280V	probably benign	Het
Dnah2	C	T	11: 69,491,555	G1243D	probably damaging	Het
Emcn	T	G	3: 137,403,991	N131K	probably damaging	Het
Fat3	A	T	9: 15,997,148	D2519E	probably damaging	Het
Fibin	T	A	2: 110,362,656	D47V	probably damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gimap8	C	A	6: 48,650,253	L54I	probably damaging	Het
Gm20481	A	G	17: 34,970,095	Y27C	unknown	Het
Gm21319	A	T	12: 87,773,546	L81Q	possibly damaging	Het
Grin1	T	G	2: 25,313,538	M154L	probably benign	Het
Ighv8-13	A	G	12: 115,765,577	L20P	probably damaging	Het
Insc	G	A	7: 114,811,615	V236I	probably benign	Het
Lrrk1	A	G	7: 66,285,279	F1031L	probably benign	Het
Man2a2	C	A	7: 80,359,751	R785L	probably benign	Het
Mcur1	C	A	13: 43,544,455		probably null	Het
Med12l	A	C	3: 59,258,254	R1464S	probably damaging	Het
Mycbp2	A	T	14: 103,282,679	M767K	possibly damaging	Het
Naalad2	T	C	9: 18,323,487	I762V	probably benign	Het
Nfkbid	A	G	7: 30,426,256	T357A	possibly damaging	Het
Pcdh17	A	G	14: 84,533,549	R1156G	possibly damaging	Het
Pcdhb1	T	C	18: 37,267,392	S799P	possibly damaging	Het
Plcg1	T	C	2: 160,753,926	Y572H	possibly damaging	Het
Plxna4	A	G	6: 32,517,264	L139P	probably damaging	Het
Psma1	A	G	7: 114,274,448	Y6H	probably damaging	Het
Psmd2	A	G	16: 20,652,627	E76G	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Pyy	T	G	11: 102,107,273	D27A	possibly damaging	Het
Slc22a2	A	G	17: 12,584,341	T21A	probably benign	Het
Slc25a2	T	C	18: 37,638,147	I110V	probably benign	Het
Sult1c2	A	C	17: 53,838,394	W85G	probably damaging	Het
Svs1	A	G	6: 48,990,149	Y677C	probably damaging	Het
Syt12	C	T	19: 4,453,950	D218N	probably damaging	Het
Tln1	C	T	4: 43,540,616	V1462M	probably damaging	Het
Tor1aip2	T	A	1: 156,051,976	N33K	possibly damaging	Het
Usp17lb	C	A	7: 104,841,591	W43L	probably benign	Het
Vmn1r76	A	G	7: 11,930,685	Y201H	possibly damaging	Het
Wnk1	C	A	6: 120,038,212		probably benign	Het
Wrnip1	A	G	13: 32,802,749	D171G	probably benign	Het
Zar1	T	A	5: 72,580,816	N81I	probably damaging	Het
Zbtb45	T	C	7: 13,007,156	T392A	probably benign	Het
Zfp445	T	C	9: 122,854,778	E272G	probably damaging	Het

Other mutations in Pde3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01388:Pde3a	APN	6	141459738	missense	probably damaging	1.00
IGL01400:Pde3a	APN	6	141459228	missense	probably benign	0.02
IGL01752:Pde3a	APN	6	141487613	splice site	probably benign
IGL01819:Pde3a	APN	6	141487537	missense	probably damaging	1.00
IGL02014:Pde3a	APN	6	141459144	missense	probably null	1.00
IGL02119:Pde3a	APN	6	141459803	missense	probably damaging	0.97
IGL02465:Pde3a	APN	6	141249675	missense	possibly damaging	0.53
IGL02677:Pde3a	APN	6	141405172	splice site	probably benign
IGL02961:Pde3a	APN	6	141459700	nonsense	probably null
IGL03034:Pde3a	APN	6	141492400	splice site	probably benign
IGL03142:Pde3a	APN	6	141492299	missense	probably benign	0.01
PIT4305001:Pde3a	UTSW	6	141492310	missense	probably benign	0.04
R0412:Pde3a	UTSW	6	141498684	missense	probably damaging	1.00
R0517:Pde3a	UTSW	6	141498657	nonsense	probably null
R0573:Pde3a	UTSW	6	141492231	missense	probably damaging	1.00
R0621:Pde3a	UTSW	6	141249999	missense	probably damaging	1.00
R0781:Pde3a	UTSW	6	141459316	splice site	probably benign
R1065:Pde3a	UTSW	6	141476732	splice site	probably benign
R1110:Pde3a	UTSW	6	141459316	splice site	probably benign
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1462:Pde3a	UTSW	6	141459834	missense	probably benign	0.05
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1470:Pde3a	UTSW	6	141466206	missense	probably benign	0.41
R1480:Pde3a	UTSW	6	141487574	missense	probably benign	0.17
R1559:Pde3a	UTSW	6	141459098	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141250353	missense	probably damaging	1.00
R1862:Pde3a	UTSW	6	141487513	missense	probably damaging	1.00
R1902:Pde3a	UTSW	6	141498770	missense	probably benign
R1909:Pde3a	UTSW	6	141250239	missense	probably benign	0.00
R2048:Pde3a	UTSW	6	141489006	splice site	probably benign
R2144:Pde3a	UTSW	6	141490111	missense	probably benign	0.40
R2155:Pde3a	UTSW	6	141483914	missense	possibly damaging	0.70
R2208:Pde3a	UTSW	6	141250347	missense	probably damaging	0.97
R2405:Pde3a	UTSW	6	141481242	missense	probably damaging	1.00
R4592:Pde3a	UTSW	6	141459216	missense	probably benign	0.13
R4677:Pde3a	UTSW	6	141466139	missense	probably benign	0.02
R4803:Pde3a	UTSW	6	141459086	missense	probably damaging	1.00
R4887:Pde3a	UTSW	6	141470942	missense	possibly damaging	0.94
R4999:Pde3a	UTSW	6	141250025	missense	probably benign	0.00
R5055:Pde3a	UTSW	6	141487956	nonsense	probably null
R5181:Pde3a	UTSW	6	141481255	critical splice donor site	probably null
R5640:Pde3a	UTSW	6	141483915	missense	probably damaging	0.99
R5694:Pde3a	UTSW	6	141250502	missense	possibly damaging	0.48
R6176:Pde3a	UTSW	6	141498889	missense	possibly damaging	0.96
R6394:Pde3a	UTSW	6	141487511	missense	probably damaging	1.00
R6692:Pde3a	UTSW	6	141479346	missense	probably damaging	1.00
R6968:Pde3a	UTSW	6	141487932	missense	probably damaging	1.00
R7163:Pde3a	UTSW	6	141487544	missense	probably damaging	1.00
R7677:Pde3a	UTSW	6	141250257	missense	probably damaging	1.00
R7754:Pde3a	UTSW	6	141459249	missense	probably benign	0.32
R8037:Pde3a	UTSW	6	141483924	missense	possibly damaging	0.82
R8123:Pde3a	UTSW	6	141466191	missense	probably benign	0.00
R8206:Pde3a	UTSW	6	141487885	missense	probably damaging	1.00
R8262:Pde3a	UTSW	6	141487801	missense	possibly damaging	0.89
R8376:Pde3a	UTSW	6	141481221	missense	possibly damaging	0.50
R8893:Pde3a	UTSW	6	141459796	missense	probably damaging	1.00
R9037:Pde3a	UTSW	6	141471106	missense	probably damaging	1.00
R9158:Pde3a	UTSW	6	141249888	missense	probably benign
R9222:Pde3a	UTSW	6	141492178	missense	probably damaging	1.00
R9318:Pde3a	UTSW	6	141479476	missense	probably benign	0.01
R9385:Pde3a	UTSW	6	141492256	missense	probably benign	0.30
X0053:Pde3a	UTSW	6	141483969	splice site	probably null
X0062:Pde3a	UTSW	6	141249984	missense	probably damaging	1.00
Z1177:Pde3a	UTSW	6	141250469	missense	probably benign	0.39

Predicted Primers

PCR Primer
(F):5'- CTTGAAAACTGCACTAAAGCAACTG -3'
(R):5'- TCTGTCTGCAAACACAGCTC -3'

Sequencing Primer
(F):5'- CTGCACTAAAGCAACTGAGATAGGC -3'
(R):5'- CGCTCTACCCATGGTCACAG -3'

Posted On

2019-05-15