Incidental Mutation 'R7137:Nfkbid'
ID553127
Institutional Source Beutler Lab
Gene Symbol Nfkbid
Ensembl Gene ENSMUSG00000036931
Gene Namenuclear factor of kappa light polypeptide gene enhancer in B cells inhibitor, delta
SynonymsIkappaBNS
MMRRC Submission
Accession Numbers

Genbank: NM_172142; MGI: 3041243

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R7137 (G1)
Quality Score218.009
Status Not validated
Chromosome7
Chromosomal Location30421732-30428746 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30426256 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 357 (T357A)
Ref Sequence ENSEMBL: ENSMUSP00000103811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046177] [ENSMUST00000108175] [ENSMUST00000108176]
Predicted Effect probably benign
Transcript: ENSMUST00000046177
AA Change: T214A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042317
Gene: ENSMUSG00000036931
AA Change: T214A

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108175
AA Change: T214A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000103810
Gene: ENSMUSG00000036931
AA Change: T214A

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108176
AA Change: T357A

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000103811
Gene: ENSMUSG00000036931
AA Change: T357A

DomainStartEndE-ValueType
low complexity region 24 41 N/A INTRINSIC
low complexity region 71 83 N/A INTRINSIC
ANK 98 127 2.07e-2 SMART
ANK 131 160 1.5e1 SMART
ANK 166 215 5.58e1 SMART
ANK 220 250 4.93e0 SMART
ANK 257 290 8.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele produce higher levels of IL-6 following stimulation and are more susceptible to chemically induced endotoxin shock and colitis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Nfkbid
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Nfkbid APN 7 30425264 nonsense probably null
IGL02809:Nfkbid APN 7 30425235 missense possibly damaging 0.60
bumble UTSW 7 30425411 critical splice donor site probably benign
R1515:Nfkbid UTSW 7 30425356 missense probably benign 0.00
R5550:Nfkbid UTSW 7 30426001 missense probably damaging 0.99
R6190:Nfkbid UTSW 7 30425737 missense probably damaging 1.00
R6668:Nfkbid UTSW 7 30424441 missense probably benign 0.00
R6994:Nfkbid UTSW 7 30425767 missense probably benign
R7788:Nfkbid UTSW 7 30427178 missense probably damaging 1.00
R8126:Nfkbid UTSW 7 30424374 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGCAAGTCCCTCGCTATGTG -3'
(R):5'- GACTGAATCATAAGTACGGGAGCTG -3'

Sequencing Primer
(F):5'- GTGCATTCCACAGGCCTTAC -3'
(R):5'- CATTTAGTGCCCCTGGA -3'
Posted On2019-05-15