Incidental Mutation 'R7137:Usp17lb'
ID553130
Institutional Source Beutler Lab
Gene Symbol Usp17lb
Ensembl Gene ENSMUSG00000062369
Gene Nameubiquitin specific peptidase 17-like B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location104840257-104842603 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 104841591 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 43 (W43L)
Ref Sequence ENSEMBL: ENSMUSP00000075822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076501] [ENSMUST00000106814]
Predicted Effect probably benign
Transcript: ENSMUST00000076501
AA Change: W43L

PolyPhen 2 Score 0.149 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000075822
Gene: ENSMUSG00000062369
AA Change: W43L

DomainStartEndE-ValueType
Pfam:UCH 50 345 3.2e-55 PFAM
Pfam:UCH_1 51 327 6.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106814
AA Change: W42L

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102427
Gene: ENSMUSG00000062369
AA Change: W42L

DomainStartEndE-ValueType
Pfam:UCH 49 344 2.3e-61 PFAM
Pfam:UCH_1 50 326 1.5e-30 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Usp17lb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01559:Usp17lb APN 7 104841229 missense probably damaging 0.98
IGL01571:Usp17lb APN 7 104840381 missense possibly damaging 0.59
IGL01624:Usp17lb APN 7 104842513 utr 5 prime probably benign
IGL02582:Usp17lb APN 7 104840730 missense probably damaging 1.00
IGL03193:Usp17lb APN 7 104841277 missense possibly damaging 0.46
R0399:Usp17lb UTSW 7 104841151 missense possibly damaging 0.81
R0420:Usp17lb UTSW 7 104840539 missense probably benign
R1202:Usp17lb UTSW 7 104842488 missense probably damaging 0.98
R1628:Usp17lb UTSW 7 104840841 missense probably damaging 1.00
R2085:Usp17lb UTSW 7 104840415 missense possibly damaging 0.73
R2214:Usp17lb UTSW 7 104841432 missense probably benign 0.36
R2283:Usp17lb UTSW 7 104840652 missense possibly damaging 0.68
R2866:Usp17lb UTSW 7 104840748 missense probably damaging 1.00
R3433:Usp17lb UTSW 7 104841648 missense possibly damaging 0.89
R5004:Usp17lb UTSW 7 104841677 missense probably benign 0.00
R5090:Usp17lb UTSW 7 104841083 missense probably benign 0.06
R5143:Usp17lb UTSW 7 104841478 missense probably damaging 1.00
R5366:Usp17lb UTSW 7 104840408 missense possibly damaging 0.95
R5568:Usp17lb UTSW 7 104841208 missense probably damaging 1.00
R5605:Usp17lb UTSW 7 104840640 missense probably benign 0.00
R5647:Usp17lb UTSW 7 104840674 missense possibly damaging 0.92
R5981:Usp17lb UTSW 7 104841187 missense probably damaging 1.00
R5999:Usp17lb UTSW 7 104840345 missense probably damaging 0.99
R6114:Usp17lb UTSW 7 104840364 missense possibly damaging 0.87
R6185:Usp17lb UTSW 7 104841424 missense probably benign 0.22
R6279:Usp17lb UTSW 7 104840691 missense probably damaging 1.00
R6300:Usp17lb UTSW 7 104840691 missense probably damaging 1.00
R6891:Usp17lb UTSW 7 104841100 missense probably benign 0.02
R7000:Usp17lb UTSW 7 104841285 missense probably damaging 1.00
R7318:Usp17lb UTSW 7 104841133 missense probably benign 0.03
R7372:Usp17lb UTSW 7 104841706 splice site probably null
R7809:Usp17lb UTSW 7 104841213 missense probably damaging 1.00
R7834:Usp17lb UTSW 7 104841511 missense probably damaging 1.00
R8008:Usp17lb UTSW 7 104841274 missense possibly damaging 0.82
R8283:Usp17lb UTSW 7 104840806 missense probably damaging 0.98
R8385:Usp17lb UTSW 7 104840623 missense possibly damaging 0.82
X0021:Usp17lb UTSW 7 104841316 missense probably damaging 1.00
Z1088:Usp17lb UTSW 7 104841129 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTTCCATAGCACACATCTTACAG -3'
(R):5'- AAGGCCTTTTGTAGCTTGCA -3'

Sequencing Primer
(F):5'- ACATCTTACAGCCTTCTGGGGAAC -3'
(R):5'- CCTGTAACATAATGGTGGGTCC -3'
Posted On2019-05-15