Incidental Mutation 'R7137:Pyy'
ID553140
Institutional Source Beutler Lab
Gene Symbol Pyy
Ensembl Gene ENSMUSG00000017311
Gene Namepeptide YY
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Not available question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location102106676-102107832 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102107273 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 27 (D27A)
Ref Sequence ENSEMBL: ENSMUSP00000017455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017455] [ENSMUST00000127381] [ENSMUST00000177304]
Predicted Effect possibly damaging
Transcript: ENSMUST00000017455
AA Change: D27A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000017455
Gene: ENSMUSG00000017311
AA Change: D27A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PAH 29 64 9.28e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000127381
AA Change: D27A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000134812
Gene: ENSMUSG00000017311
AA Change: D27A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PAH 29 64 9.28e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000177304
AA Change: D27A

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000135292
Gene: ENSMUSG00000017311
AA Change: D27A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PAH 29 64 9.28e-18 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded preproprotein is proteolytically processed to generate two alternative peptide products that differ in length by three amino acids. These peptides, secreted by endocrine cells in the gut, exhibit different binding affinities for each of the neuropeptide Y receptors. Binding of the encoded peptides to these receptors mediates regulation of pancreatic secretion, gut mobility and energy homeostasis. Rare variations in this gene could increase susceptibility to obesity and elevated serum levels of the encoded peptides may be associated with anorexia nervosa. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one null mutation showed normal growth, food intake, and energy expenditure. Mice homozygous for another null allele exhibit polyphagia, increased adipose tissue and are resistant to the benefits of a high-protein diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Pyy
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4664:Pyy UTSW 11 102107352 start codon destroyed possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- GTTTGGAGAACAGAGCTGCG -3'
(R):5'- ACTGAGGCTAGAGATGGTGC -3'

Sequencing Primer
(F):5'- TTTCCATACCTGGGGGCG -3'
(R):5'- CGGTAGAAGACTAGGTGAATCC -3'
Posted On2019-05-15