Incidental Mutation 'R7137:Cep170b'
ID553143
Institutional Source Beutler Lab
Gene Symbol Cep170b
Ensembl Gene ENSMUSG00000072825
Gene Namecentrosomal protein 170B
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.442) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location112720455-112746592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112735167 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 160 (V160A)
Ref Sequence ENSEMBL: ENSMUSP00000098580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092279] [ENSMUST00000101018] [ENSMUST00000179041] [ENSMUST00000220627] [ENSMUST00000222711]
Predicted Effect unknown
Transcript: ENSMUST00000092279
AA Change: V160A
SMART Domains Protein: ENSMUSP00000089930
Gene: ENSMUSG00000072825
AA Change: V160A

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
Pfam:CEP170_C 204 598 8.9e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101018
AA Change: V160A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000098580
Gene: ENSMUSG00000072825
AA Change: V160A

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 831 1514 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179041
AA Change: V160A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137331
Gene: ENSMUSG00000072825
AA Change: V160A

DomainStartEndE-ValueType
FHA 22 73 4.65e-10 SMART
low complexity region 370 382 N/A INTRINSIC
low complexity region 535 548 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 739 757 N/A INTRINSIC
Pfam:CEP170_C 832 1510 4.3e-303 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220627
AA Change: V160A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000222711
AA Change: V160A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Cep170b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cep170b APN 12 112735194 missense probably damaging 1.00
IGL01313:Cep170b APN 12 112735652 missense probably damaging 1.00
IGL01317:Cep170b APN 12 112737644 missense probably damaging 1.00
IGL01660:Cep170b APN 12 112744160 missense probably damaging 1.00
IGL02032:Cep170b APN 12 112737333 critical splice donor site probably null
IGL02505:Cep170b APN 12 112743070 missense probably damaging 1.00
IGL02966:Cep170b APN 12 112736444 missense possibly damaging 0.75
IGL03111:Cep170b APN 12 112735179 missense probably damaging 1.00
IGL03367:Cep170b APN 12 112737238 missense probably benign 0.00
R0348:Cep170b UTSW 12 112736806 missense probably damaging 1.00
R0562:Cep170b UTSW 12 112739189 missense probably benign 0.00
R0909:Cep170b UTSW 12 112732039 missense probably null 0.06
R1217:Cep170b UTSW 12 112740905 missense probably damaging 0.99
R1300:Cep170b UTSW 12 112737257 missense probably benign 0.02
R1647:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1648:Cep170b UTSW 12 112736372 missense probably damaging 1.00
R1652:Cep170b UTSW 12 112733513 missense probably damaging 0.99
R1737:Cep170b UTSW 12 112736627 missense possibly damaging 0.71
R1936:Cep170b UTSW 12 112735738 missense probably damaging 1.00
R1962:Cep170b UTSW 12 112738061 missense probably damaging 1.00
R2094:Cep170b UTSW 12 112735730 missense possibly damaging 0.90
R2208:Cep170b UTSW 12 112738985 missense probably benign 0.00
R3418:Cep170b UTSW 12 112738468 nonsense probably null
R3735:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R3736:Cep170b UTSW 12 112741004 missense probably damaging 1.00
R4299:Cep170b UTSW 12 112739305 missense probably damaging 1.00
R4577:Cep170b UTSW 12 112744718 missense probably damaging 1.00
R5199:Cep170b UTSW 12 112744147 missense probably damaging 1.00
R5512:Cep170b UTSW 12 112733485 missense possibly damaging 0.86
R5575:Cep170b UTSW 12 112735632 missense probably damaging 1.00
R5643:Cep170b UTSW 12 112740841 missense probably benign 0.35
R6074:Cep170b UTSW 12 112744155 missense probably damaging 1.00
R6265:Cep170b UTSW 12 112744559 missense probably damaging 1.00
R6371:Cep170b UTSW 12 112740945 missense probably damaging 1.00
R6376:Cep170b UTSW 12 112732068 missense probably damaging 0.99
R7055:Cep170b UTSW 12 112735715 missense probably damaging 1.00
R7226:Cep170b UTSW 12 112737925 missense possibly damaging 0.80
R7615:Cep170b UTSW 12 112744665 missense probably damaging 1.00
R7831:Cep170b UTSW 12 112744800 missense probably benign 0.08
R8178:Cep170b UTSW 12 112739285 missense possibly damaging 0.92
R8492:Cep170b UTSW 12 112744700 missense probably damaging 1.00
Z1176:Cep170b UTSW 12 112741012 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGTGAGAGGCTCAAGACAG -3'
(R):5'- ACCATTTTGCTGTGCCAGG -3'

Sequencing Primer
(F):5'- GCCATCTTCACCCACAGATGTG -3'
(R):5'- GCTGTGCCAGGTCCTTG -3'
Posted On2019-05-15