Mutagenetix > Incidental Mutations

Incidental Mutation 'R7137:Pcdh17'

553147

Institutional Source

Beutler Lab

Gene Symbol

Pcdh17

Ensembl Gene

ENSMUSG00000035566

Gene Name

protocadherin 17

Synonyms

C030033F14Rik, LOC219228

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.156) question?

Stock #

R7137 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84443563-84539002 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 84533549 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 1156 (R1156G)

Ref Sequence

ENSEMBL: ENSMUSP00000071325 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071370]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071370
AA Change: R1156G

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000071325
Gene: ENSMUSG00000035566
AA Change: R1156G

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
CA	54	131	6.8e-4	SMART
CA	155	242	8.81e-21	SMART
CA	266	350	8.27e-26	SMART
CA	375	468	9.14e-28	SMART
CA	492	579	8.4e-27	SMART
CA	608	687	2.53e-12	SMART
low complexity region	703	725	N/A	INTRINSIC
low complexity region	751	759	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene belongs to the protocadherin gene family, a subfamily of the cadherin superfamily. The encoded protein contains six extracellular cadherin domains, a transmembrane domain, and a cytoplasmic tail differing from those of the classical cadherins. The encoded protein may play a role in the establishment and function of specific cell-cell connections in the brain. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired synaptic transmission, increased synaptic vesicle number and decreased depression-related behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,677,985	S1423P	possibly damaging	Het
Acvr1c	A	G	2: 58,283,387		probably null	Het
Adgrf5	A	G	17: 43,450,897	K1161R	probably damaging	Het
Arhgap32	T	G	9: 32,151,936	D80E	probably benign	Het
Aspg	T	C	12: 112,112,198	V30A	possibly damaging	Het
Bcl2a1d	T	C	9: 88,731,478	D81G	probably damaging	Het
Cep170b	T	C	12: 112,735,167	V160A	probably benign	Het
Ces1c	T	C	8: 93,130,842	Y37C	probably benign	Het
Cntnap5a	T	C	1: 116,089,376	L233P	probably damaging	Het
Crem	C	A	18: 3,273,459	A245S	possibly damaging	Het
Cyp2d12	C	T	15: 82,557,821	A280V	probably benign	Het
Dnah2	C	T	11: 69,491,555	G1243D	probably damaging	Het
Emcn	T	G	3: 137,403,991	N131K	probably damaging	Het
Fat3	A	T	9: 15,997,148	D2519E	probably damaging	Het
Fibin	T	A	2: 110,362,656	D47V	probably damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gimap8	C	A	6: 48,650,253	L54I	probably damaging	Het
Gm20481	A	G	17: 34,970,095	Y27C	unknown	Het
Gm21319	A	T	12: 87,773,546	L81Q	possibly damaging	Het
Grin1	T	G	2: 25,313,538	M154L	probably benign	Het
Ighv8-13	A	G	12: 115,765,577	L20P	probably damaging	Het
Insc	G	A	7: 114,811,615	V236I	probably benign	Het
Lrrk1	A	G	7: 66,285,279	F1031L	probably benign	Het
Man2a2	C	A	7: 80,359,751	R785L	probably benign	Het
Mcur1	C	A	13: 43,544,455		probably null	Het
Med12l	A	C	3: 59,258,254	R1464S	probably damaging	Het
Mycbp2	A	T	14: 103,282,679	M767K	possibly damaging	Het
Naalad2	T	C	9: 18,323,487	I762V	probably benign	Het
Nfkbid	A	G	7: 30,426,256	T357A	possibly damaging	Het
Pcdhb1	T	C	18: 37,267,392	S799P	possibly damaging	Het
Pde3a	A	T	6: 141,498,746	E1093D	probably benign	Het
Plcg1	T	C	2: 160,753,926	Y572H	possibly damaging	Het
Plxna4	A	G	6: 32,517,264	L139P	probably damaging	Het
Psma1	A	G	7: 114,274,448	Y6H	probably damaging	Het
Psmd2	A	G	16: 20,652,627	E76G	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Pyy	T	G	11: 102,107,273	D27A	possibly damaging	Het
Slc22a2	A	G	17: 12,584,341	T21A	probably benign	Het
Slc25a2	T	C	18: 37,638,147	I110V	probably benign	Het
Sult1c2	A	C	17: 53,838,394	W85G	probably damaging	Het
Svs1	A	G	6: 48,990,149	Y677C	probably damaging	Het
Syt12	C	T	19: 4,453,950	D218N	probably damaging	Het
Tln1	C	T	4: 43,540,616	V1462M	probably damaging	Het
Tor1aip2	T	A	1: 156,051,976	N33K	possibly damaging	Het
Usp17lb	C	A	7: 104,841,591	W43L	probably benign	Het
Vmn1r76	A	G	7: 11,930,685	Y201H	possibly damaging	Het
Wnk1	C	A	6: 120,038,212		probably benign	Het
Wrnip1	A	G	13: 32,802,749	D171G	probably benign	Het
Zar1	T	A	5: 72,580,816	N81I	probably damaging	Het
Zbtb45	T	C	7: 13,007,156	T392A	probably benign	Het
Zfp445	T	C	9: 122,854,778	E272G	probably damaging	Het

Other mutations in Pcdh17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Pcdh17	APN	14	84447544	missense	probably damaging	1.00
IGL00902:Pcdh17	APN	14	84446849	missense	probably damaging	1.00
IGL01596:Pcdh17	APN	14	84448192	missense	probably damaging	1.00
IGL01665:Pcdh17	APN	14	84447002	missense	probably damaging	0.99
IGL01944:Pcdh17	APN	14	84447520	missense	probably benign	0.01
IGL01944:Pcdh17	APN	14	84447521	missense	probably damaging	0.98
IGL01977:Pcdh17	APN	14	84533097	missense	possibly damaging	0.49
IGL01988:Pcdh17	APN	14	84446622	missense	probably damaging	1.00
IGL02168:Pcdh17	APN	14	84533195	missense	probably benign	0.19
IGL02500:Pcdh17	APN	14	84533469	missense	probably benign	0.17
IGL02874:Pcdh17	APN	14	84448240	missense	possibly damaging	0.71
IGL02882:Pcdh17	APN	14	84446661	missense	probably damaging	0.98
IGL02941:Pcdh17	APN	14	84448307	missense	probably damaging	1.00
IGL03328:Pcdh17	APN	14	84533111	missense	probably benign
PIT4151001:Pcdh17	UTSW	14	84447358	missense	probably benign	0.05
R0226:Pcdh17	UTSW	14	84448201	missense	probably damaging	0.99
R0537:Pcdh17	UTSW	14	84447457	missense	probably damaging	1.00
R0647:Pcdh17	UTSW	14	84447773	missense	possibly damaging	0.58
R0939:Pcdh17	UTSW	14	84447755	missense	probably damaging	1.00
R1014:Pcdh17	UTSW	14	84447488	missense	probably damaging	1.00
R1753:Pcdh17	UTSW	14	84477654	missense	probably benign	0.17
R3404:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3405:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3406:Pcdh17	UTSW	14	84446622	missense	probably damaging	1.00
R3746:Pcdh17	UTSW	14	84533037	missense	probably benign	0.02
R3852:Pcdh17	UTSW	14	84447259	nonsense	probably null
R4015:Pcdh17	UTSW	14	84447107	missense	probably damaging	0.99
R4348:Pcdh17	UTSW	14	84447620	missense	probably damaging	0.97
R4365:Pcdh17	UTSW	14	84448286	missense	probably damaging	0.97
R4375:Pcdh17	UTSW	14	84448271	missense	possibly damaging	0.80
R4693:Pcdh17	UTSW	14	84533520	missense	probably damaging	1.00
R4811:Pcdh17	UTSW	14	84447935	missense	probably damaging	1.00
R5007:Pcdh17	UTSW	14	84533297	missense	probably benign
R5074:Pcdh17	UTSW	14	84533342	missense	probably benign
R5080:Pcdh17	UTSW	14	84533310	missense	probably benign	0.01
R5138:Pcdh17	UTSW	14	84447209	missense	probably damaging	1.00
R5330:Pcdh17	UTSW	14	84533046	missense	probably damaging	1.00
R5541:Pcdh17	UTSW	14	84447416	missense	probably damaging	0.97
R5686:Pcdh17	UTSW	14	84532993	missense	probably damaging	1.00
R5692:Pcdh17	UTSW	14	84448540	missense	probably benign	0.22
R5695:Pcdh17	UTSW	14	84446360	missense	probably damaging	1.00
R5949:Pcdh17	UTSW	14	84447556	missense	probably damaging	1.00
R6127:Pcdh17	UTSW	14	84533060	missense	probably damaging	0.96
R6294:Pcdh17	UTSW	14	84477668	missense	probably benign	0.01
R6508:Pcdh17	UTSW	14	84447979	missense	probably damaging	1.00
R6726:Pcdh17	UTSW	14	84446217	missense	probably damaging	1.00
R7094:Pcdh17	UTSW	14	84447395	missense	probably damaging	1.00
R7828:Pcdh17	UTSW	14	84532985	missense	probably damaging	0.99
R7904:Pcdh17	UTSW	14	84448484	missense	possibly damaging	0.94
R8507:Pcdh17	UTSW	14	84445944	start gained	probably benign
X0025:Pcdh17	UTSW	14	84446562	missense	possibly damaging	0.86
X0026:Pcdh17	UTSW	14	84533097	missense	possibly damaging	0.49
X0027:Pcdh17	UTSW	14	84448310	missense	possibly damaging	0.80
Z1088:Pcdh17	UTSW	14	84448274	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GTCTTCGCGGATGTGCATTC -3'
(R):5'- TGCATACCTTCCTAACAGATTGTC -3'

Sequencing Primer
(F):5'- ATGTGCATTCCAGAGCCCGTAG -3'
(R):5'- CCTTCCTAACAGATTGTCAAAAGG -3'

Posted On

2019-05-15