Incidental Mutation 'R7137:Cyp2d12'
ID553150
Institutional Source Beutler Lab
Gene Symbol Cyp2d12
Ensembl Gene ENSMUSG00000096852
Gene Namecytochrome P450, family 2, subfamily d, polypeptide 12
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location82555072-82560403 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 82557821 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 280 (A280V)
Ref Sequence ENSEMBL: ENSMUSP00000071064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068861] [ENSMUST00000228974] [ENSMUST00000229103] [ENSMUST00000229904]
Predicted Effect probably benign
Transcript: ENSMUST00000068861
AA Change: A280V

PolyPhen 2 Score 0.424 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071064
Gene: ENSMUSG00000096852
AA Change: A280V

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
Pfam:p450 37 497 3.6e-143 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228974
Predicted Effect probably benign
Transcript: ENSMUST00000229103
AA Change: A154V

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000229904
AA Change: A229V

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Cyp2d12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01959:Cyp2d12 APN 15 82555344 splice site probably benign
IGL02318:Cyp2d12 APN 15 82555243 missense probably benign 0.33
IGL02353:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02360:Cyp2d12 APN 15 82558970 missense probably benign 0.02
IGL02491:Cyp2d12 APN 15 82558481 missense possibly damaging 0.88
IGL02651:Cyp2d12 APN 15 82556740 missense probably damaging 0.99
IGL02664:Cyp2d12 APN 15 82559334 missense probably benign
IGL03169:Cyp2d12 APN 15 82559291 missense probably benign 0.00
IGL03354:Cyp2d12 APN 15 82558961 missense probably damaging 1.00
PIT4581001:Cyp2d12 UTSW 15 82558451 missense probably damaging 1.00
R0426:Cyp2d12 UTSW 15 82558963 missense probably benign 0.12
R0578:Cyp2d12 UTSW 15 82556383 splice site probably benign
R1297:Cyp2d12 UTSW 15 82557686 missense probably benign 0.31
R1517:Cyp2d12 UTSW 15 82558136 missense probably damaging 1.00
R1718:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R1829:Cyp2d12 UTSW 15 82558056 missense possibly damaging 0.87
R2208:Cyp2d12 UTSW 15 82556936 missense probably damaging 1.00
R2366:Cyp2d12 UTSW 15 82555154 missense probably damaging 1.00
R2385:Cyp2d12 UTSW 15 82558495 missense probably benign 0.00
R2504:Cyp2d12 UTSW 15 82559036 missense probably benign 0.06
R4009:Cyp2d12 UTSW 15 82556292 missense probably damaging 1.00
R4940:Cyp2d12 UTSW 15 82558050 missense probably benign 0.00
R5237:Cyp2d12 UTSW 15 82558006 splice site probably null
R5327:Cyp2d12 UTSW 15 82555222 missense probably benign 0.00
R5549:Cyp2d12 UTSW 15 82556297 missense probably benign 0.23
R6128:Cyp2d12 UTSW 15 82558965 missense probably benign
R6275:Cyp2d12 UTSW 15 82556658 missense probably benign 0.00
R6723:Cyp2d12 UTSW 15 82556884 missense probably benign
R6808:Cyp2d12 UTSW 15 82556733 missense probably damaging 1.00
R6947:Cyp2d12 UTSW 15 82559047 missense probably benign
R7224:Cyp2d12 UTSW 15 82557648 splice site probably null
R7513:Cyp2d12 UTSW 15 82558420 missense probably benign
R7698:Cyp2d12 UTSW 15 82558970 missense probably benign 0.02
R7753:Cyp2d12 UTSW 15 82556963 missense possibly damaging 0.68
R8465:Cyp2d12 UTSW 15 82555177 missense possibly damaging 0.46
X0065:Cyp2d12 UTSW 15 82557828 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCGTGTCTCTCACAGGTTATTAAC -3'
(R):5'- AAGCTGCTCTCAGGATTTCC -3'

Sequencing Primer
(F):5'- TCACAGGTTATTAACACATTCCCG -3'
(R):5'- GCCACACAGAAAGGATGGTCTC -3'
Posted On2019-05-15