Mutagenetix > Incidental Mutations

Incidental Mutation 'R7137:Slc22a2'

553152

Institutional Source

Beutler Lab

Gene Symbol

Slc22a2

Ensembl Gene

ENSMUSG00000040966

Gene Name

solute carrier family 22 (organic cation transporter), member 2

Synonyms

Orct2, Oct2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7137 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

12584189-12628465 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12584341 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 21 (T21A)

Ref Sequence

ENSEMBL: ENSMUSP00000041186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046959]

Predicted Effect

probably benign
Transcript: ENSMUST00000046959
AA Change: T21A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041186
Gene: ENSMUSG00000040966
AA Change: T21A

Domain	Start	End	E-Value	Type
transmembrane domain	21	43	N/A	INTRINSIC
Pfam:Sugar_tr	80	528	7.6e-37	PFAM
Pfam:MFS_1	134	398	3.5e-21	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. This gene is one of three similar cation transporter genes located in a cluster on chromosome 6. The encoded protein contains twelve putative transmembrane domains and is a plasma integral membrane protein. It is found primarily in the kidney, where it may mediate the first step in cation reabsorption. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knockout allele are viable and fertile and display no obvious phenotypic abnormalities. No significant defects in the renal secretion of a model organic cation are observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,677,985	S1423P	possibly damaging	Het
Acvr1c	A	G	2: 58,283,387		probably null	Het
Adgrf5	A	G	17: 43,450,897	K1161R	probably damaging	Het
Arhgap32	T	G	9: 32,151,936	D80E	probably benign	Het
Aspg	T	C	12: 112,112,198	V30A	possibly damaging	Het
Bcl2a1d	T	C	9: 88,731,478	D81G	probably damaging	Het
Cep170b	T	C	12: 112,735,167	V160A	probably benign	Het
Ces1c	T	C	8: 93,130,842	Y37C	probably benign	Het
Cntnap5a	T	C	1: 116,089,376	L233P	probably damaging	Het
Crem	C	A	18: 3,273,459	A245S	possibly damaging	Het
Cyp2d12	C	T	15: 82,557,821	A280V	probably benign	Het
Dnah2	C	T	11: 69,491,555	G1243D	probably damaging	Het
Emcn	T	G	3: 137,403,991	N131K	probably damaging	Het
Fat3	A	T	9: 15,997,148	D2519E	probably damaging	Het
Fibin	T	A	2: 110,362,656	D47V	probably damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gimap8	C	A	6: 48,650,253	L54I	probably damaging	Het
Gm20481	A	G	17: 34,970,095	Y27C	unknown	Het
Gm21319	A	T	12: 87,773,546	L81Q	possibly damaging	Het
Grin1	T	G	2: 25,313,538	M154L	probably benign	Het
Ighv8-13	A	G	12: 115,765,577	L20P	probably damaging	Het
Insc	G	A	7: 114,811,615	V236I	probably benign	Het
Lrrk1	A	G	7: 66,285,279	F1031L	probably benign	Het
Man2a2	C	A	7: 80,359,751	R785L	probably benign	Het
Mcur1	C	A	13: 43,544,455		probably null	Het
Med12l	A	C	3: 59,258,254	R1464S	probably damaging	Het
Mycbp2	A	T	14: 103,282,679	M767K	possibly damaging	Het
Naalad2	T	C	9: 18,323,487	I762V	probably benign	Het
Nfkbid	A	G	7: 30,426,256	T357A	possibly damaging	Het
Pcdh17	A	G	14: 84,533,549	R1156G	possibly damaging	Het
Pcdhb1	T	C	18: 37,267,392	S799P	possibly damaging	Het
Pde3a	A	T	6: 141,498,746	E1093D	probably benign	Het
Plcg1	T	C	2: 160,753,926	Y572H	possibly damaging	Het
Plxna4	A	G	6: 32,517,264	L139P	probably damaging	Het
Psma1	A	G	7: 114,274,448	Y6H	probably damaging	Het
Psmd2	A	G	16: 20,652,627	E76G	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Pyy	T	G	11: 102,107,273	D27A	possibly damaging	Het
Slc25a2	T	C	18: 37,638,147	I110V	probably benign	Het
Sult1c2	A	C	17: 53,838,394	W85G	probably damaging	Het
Svs1	A	G	6: 48,990,149	Y677C	probably damaging	Het
Syt12	C	T	19: 4,453,950	D218N	probably damaging	Het
Tln1	C	T	4: 43,540,616	V1462M	probably damaging	Het
Tor1aip2	T	A	1: 156,051,976	N33K	possibly damaging	Het
Usp17lb	C	A	7: 104,841,591	W43L	probably benign	Het
Vmn1r76	A	G	7: 11,930,685	Y201H	possibly damaging	Het
Wnk1	C	A	6: 120,038,212		probably benign	Het
Wrnip1	A	G	13: 32,802,749	D171G	probably benign	Het
Zar1	T	A	5: 72,580,816	N81I	probably damaging	Het
Zbtb45	T	C	7: 13,007,156	T392A	probably benign	Het
Zfp445	T	C	9: 122,854,778	E272G	probably damaging	Het

Other mutations in Slc22a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00592:Slc22a2	APN	17	12608418	missense	possibly damaging	0.79
IGL00658:Slc22a2	APN	17	12615315	missense	probably benign	0.37
IGL01073:Slc22a2	APN	17	12584349	missense	probably benign	0.00
IGL01573:Slc22a2	APN	17	12605961	missense	probably damaging	0.99
IGL02000:Slc22a2	APN	17	12584383	missense	possibly damaging	0.77
IGL02943:Slc22a2	APN	17	12610061	missense	probably damaging	1.00
IGL03301:Slc22a2	APN	17	12606039	missense	probably damaging	1.00
R0492:Slc22a2	UTSW	17	12615272	missense	probably benign	0.00
R0835:Slc22a2	UTSW	17	12612431	missense	probably benign	0.01
R1330:Slc22a2	UTSW	17	12586812	missense	possibly damaging	0.94
R1432:Slc22a2	UTSW	17	12584308	missense	possibly damaging	0.89
R1559:Slc22a2	UTSW	17	12584411	missense	probably damaging	1.00
R1855:Slc22a2	UTSW	17	12586812	missense	probably damaging	0.99
R1884:Slc22a2	UTSW	17	12614826	splice site	probably benign
R2042:Slc22a2	UTSW	17	12599125	missense	probably benign	0.01
R2197:Slc22a2	UTSW	17	12599062	missense	probably damaging	1.00
R2255:Slc22a2	UTSW	17	12599175	missense	probably damaging	1.00
R2271:Slc22a2	UTSW	17	12586805	missense	probably benign
R4003:Slc22a2	UTSW	17	12612450	missense	probably benign	0.01
R4021:Slc22a2	UTSW	17	12584489	missense	probably damaging	1.00
R4093:Slc22a2	UTSW	17	12612394	missense	probably damaging	1.00
R4404:Slc22a2	UTSW	17	12614764	missense	probably damaging	1.00
R4419:Slc22a2	UTSW	17	12612586	nonsense	probably null
R4564:Slc22a2	UTSW	17	12610056	missense	probably benign	0.08
R4866:Slc22a2	UTSW	17	12584429	missense	probably damaging	1.00
R4877:Slc22a2	UTSW	17	12614815	missense	possibly damaging	0.53
R5224:Slc22a2	UTSW	17	12586832	missense	probably damaging	0.97
R5668:Slc22a2	UTSW	17	12608409	missense	probably benign
R6326:Slc22a2	UTSW	17	12612410	nonsense	probably null
R7211:Slc22a2	UTSW	17	12586883	critical splice donor site	probably null
R7378:Slc22a2	UTSW	17	12612391	missense	probably damaging	1.00
R7521:Slc22a2	UTSW	17	12586823	missense	probably benign	0.14
R7524:Slc22a2	UTSW	17	12606057	missense	possibly damaging	0.87
R7735:Slc22a2	UTSW	17	12610030	missense	probably damaging	0.99
R8136:Slc22a2	UTSW	17	12606030	missense	probably damaging	1.00
Z1088:Slc22a2	UTSW	17	12614776	missense	probably benign	0.36
Z1176:Slc22a2	UTSW	17	12584625	missense	possibly damaging	0.79
Z1177:Slc22a2	UTSW	17	12606010	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGCTGGTCCCTCTCTAAATAAG -3'
(R):5'- CATACCTCATGCACTGGCTG -3'

Sequencing Primer
(F):5'- GGTCCCTCTCTAAATAAGCTAATGC -3'
(R):5'- CTCATGCACTGGCTGAGGAAG -3'

Posted On

2019-05-15