Incidental Mutation 'R7137:Sult1c2'
ID553155
Institutional Source Beutler Lab
Gene Symbol Sult1c2
Ensembl Gene ENSMUSG00000023122
Gene Namesulfotransferase family, cytosolic, 1C, member 2
Synonyms1810008N17Rik, ST1C1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location53829637-53846339 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 53838394 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 85 (W85G)
Ref Sequence ENSEMBL: ENSMUSP00000023886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023886]
Predicted Effect probably damaging
Transcript: ENSMUST00000023886
AA Change: W85G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023886
Gene: ENSMUSG00000023122
AA Change: W85G

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 39 289 4.8e-96 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that belongs to the SULT1 subfamily, responsible for transferring a sulfo moiety from PAPS to phenol-containing compounds. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Sult1c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Sult1c2 APN 17 53833119 nonsense probably null
IGL01938:Sult1c2 APN 17 53831926 missense probably damaging 1.00
IGL03130:Sult1c2 APN 17 53830071 missense probably benign 0.38
R0659:Sult1c2 UTSW 17 53831778 missense probably damaging 1.00
R1570:Sult1c2 UTSW 17 53836963 missense probably benign 0.00
R1574:Sult1c2 UTSW 17 53836899 critical splice donor site probably null
R1574:Sult1c2 UTSW 17 53836899 critical splice donor site probably null
R2232:Sult1c2 UTSW 17 53831820 missense probably benign 0.01
R2315:Sult1c2 UTSW 17 53838493 missense possibly damaging 0.90
R4677:Sult1c2 UTSW 17 53830109 missense possibly damaging 0.80
R4896:Sult1c2 UTSW 17 53832135 missense probably benign 0.31
R5396:Sult1c2 UTSW 17 53836911 missense possibly damaging 0.95
R5941:Sult1c2 UTSW 17 53831898 missense probably benign 0.01
R8025:Sult1c2 UTSW 17 53831809 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCAGAATTTTGCCTCCATATGC -3'
(R):5'- AGGTAAAGCCAACATCTGCATC -3'

Sequencing Primer
(F):5'- GATCTCTATGAGCTCAAGGCCAG -3'
(R):5'- GCATCCACACCCCTTCATTAGTATG -3'
Posted On2019-05-15