Mutagenetix > Incidental Mutations

Incidental Mutation 'R7137:Sult1c2'

553155

Institutional Source

Beutler Lab

Gene Symbol

Sult1c2

Ensembl Gene

ENSMUSG00000023122

Gene Name

sulfotransferase family, cytosolic, 1C, member 2

Synonyms

1810008N17Rik, ST1C1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R7137 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

53829637-53846339 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 53838394 bp

Zygosity

Heterozygous

Amino Acid Change

Tryptophan to Glycine at position 85 (W85G)

Ref Sequence

ENSEMBL: ENSMUSP00000023886 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023886]

Predicted Effect

probably damaging
Transcript: ENSMUST00000023886
AA Change: W85G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000023886
Gene: ENSMUSG00000023122
AA Change: W85G

Domain	Start	End	E-Value	Type
Pfam:Sulfotransfer_1	39	289	4.8e-96	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfotransferase enzymes catalyze the sulfate conjugation of many hormones, neurotransmitters, drugs, and xenobiotic compounds. These cytosolic enzymes are different in their tissue distributions and substrate specificities. The gene structure (number and length of exons) is similar among family members. This gene encodes a protein that belongs to the SULT1 subfamily, responsible for transferring a sulfo moiety from PAPS to phenol-containing compounds. Two alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,677,985	S1423P	possibly damaging	Het
Acvr1c	A	G	2: 58,283,387		probably null	Het
Adgrf5	A	G	17: 43,450,897	K1161R	probably damaging	Het
Arhgap32	T	G	9: 32,151,936	D80E	probably benign	Het
Aspg	T	C	12: 112,112,198	V30A	possibly damaging	Het
Bcl2a1d	T	C	9: 88,731,478	D81G	probably damaging	Het
Cep170b	T	C	12: 112,735,167	V160A	probably benign	Het
Ces1c	T	C	8: 93,130,842	Y37C	probably benign	Het
Cntnap5a	T	C	1: 116,089,376	L233P	probably damaging	Het
Crem	C	A	18: 3,273,459	A245S	possibly damaging	Het
Cyp2d12	C	T	15: 82,557,821	A280V	probably benign	Het
Dnah2	C	T	11: 69,491,555	G1243D	probably damaging	Het
Emcn	T	G	3: 137,403,991	N131K	probably damaging	Het
Fat3	A	T	9: 15,997,148	D2519E	probably damaging	Het
Fibin	T	A	2: 110,362,656	D47V	probably damaging	Het
Fsd1	G	A	17: 55,993,876	R245H	probably damaging	Het
Gimap8	C	A	6: 48,650,253	L54I	probably damaging	Het
Gm20481	A	G	17: 34,970,095	Y27C	unknown	Het
Gm21319	A	T	12: 87,773,546	L81Q	possibly damaging	Het
Grin1	T	G	2: 25,313,538	M154L	probably benign	Het
Ighv8-13	A	G	12: 115,765,577	L20P	probably damaging	Het
Insc	G	A	7: 114,811,615	V236I	probably benign	Het
Lrrk1	A	G	7: 66,285,279	F1031L	probably benign	Het
Man2a2	C	A	7: 80,359,751	R785L	probably benign	Het
Mcur1	C	A	13: 43,544,455		probably null	Het
Med12l	A	C	3: 59,258,254	R1464S	probably damaging	Het
Mycbp2	A	T	14: 103,282,679	M767K	possibly damaging	Het
Naalad2	T	C	9: 18,323,487	I762V	probably benign	Het
Nfkbid	A	G	7: 30,426,256	T357A	possibly damaging	Het
Pcdh17	A	G	14: 84,533,549	R1156G	possibly damaging	Het
Pcdhb1	T	C	18: 37,267,392	S799P	possibly damaging	Het
Pde3a	A	T	6: 141,498,746	E1093D	probably benign	Het
Plcg1	T	C	2: 160,753,926	Y572H	possibly damaging	Het
Plxna4	A	G	6: 32,517,264	L139P	probably damaging	Het
Psma1	A	G	7: 114,274,448	Y6H	probably damaging	Het
Psmd2	A	G	16: 20,652,627	E76G	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Pyy	T	G	11: 102,107,273	D27A	possibly damaging	Het
Slc22a2	A	G	17: 12,584,341	T21A	probably benign	Het
Slc25a2	T	C	18: 37,638,147	I110V	probably benign	Het
Svs1	A	G	6: 48,990,149	Y677C	probably damaging	Het
Syt12	C	T	19: 4,453,950	D218N	probably damaging	Het
Tln1	C	T	4: 43,540,616	V1462M	probably damaging	Het
Tor1aip2	T	A	1: 156,051,976	N33K	possibly damaging	Het
Usp17lb	C	A	7: 104,841,591	W43L	probably benign	Het
Vmn1r76	A	G	7: 11,930,685	Y201H	possibly damaging	Het
Wnk1	C	A	6: 120,038,212		probably benign	Het
Wrnip1	A	G	13: 32,802,749	D171G	probably benign	Het
Zar1	T	A	5: 72,580,816	N81I	probably damaging	Het
Zbtb45	T	C	7: 13,007,156	T392A	probably benign	Het
Zfp445	T	C	9: 122,854,778	E272G	probably damaging	Het

Other mutations in Sult1c2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Sult1c2	APN	17	53833119	nonsense	probably null
IGL01938:Sult1c2	APN	17	53831926	missense	probably damaging	1.00
IGL03130:Sult1c2	APN	17	53830071	missense	probably benign	0.38
R0659:Sult1c2	UTSW	17	53831778	missense	probably damaging	1.00
R1570:Sult1c2	UTSW	17	53836963	missense	probably benign	0.00
R1574:Sult1c2	UTSW	17	53836899	critical splice donor site	probably null
R1574:Sult1c2	UTSW	17	53836899	critical splice donor site	probably null
R2232:Sult1c2	UTSW	17	53831820	missense	probably benign	0.01
R2315:Sult1c2	UTSW	17	53838493	missense	possibly damaging	0.90
R4677:Sult1c2	UTSW	17	53830109	missense	possibly damaging	0.80
R4896:Sult1c2	UTSW	17	53832135	missense	probably benign	0.31
R5396:Sult1c2	UTSW	17	53836911	missense	possibly damaging	0.95
R5941:Sult1c2	UTSW	17	53831898	missense	probably benign	0.01
R8025:Sult1c2	UTSW	17	53831809	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GCAGAATTTTGCCTCCATATGC -3'
(R):5'- AGGTAAAGCCAACATCTGCATC -3'

Sequencing Primer
(F):5'- GATCTCTATGAGCTCAAGGCCAG -3'
(R):5'- GCATCCACACCCCTTCATTAGTATG -3'

Posted On

2019-05-15