Incidental Mutation 'R7137:Fsd1'
ID553156
Institutional Source Beutler Lab
Gene Symbol Fsd1
Ensembl Gene ENSMUSG00000011589
Gene Namefibronectin type 3 and SPRY domain-containing protein
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_183178.2; Ensembl: ENSMUST00000011733

Is this an essential gene? Possibly non essential (E-score: 0.492) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location55986511-55996881 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55993876 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 245 (R245H)
Ref Sequence ENSEMBL: ENSMUSP00000011733 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]
Predicted Effect probably damaging
Transcript: ENSMUST00000011733
AA Change: R245H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589
AA Change: R245H

DomainStartEndE-ValueType
BBC 4 130 7.61e-9 SMART
FN3 165 255 2.96e-4 SMART
Pfam:SPRY 355 473 6.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000043785
SMART Domains Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781

DomainStartEndE-ValueType
PH 20 120 1.22e-3 SMART
SH2 150 239 2.58e-3 SMART
low complexity region 278 297 N/A INTRINSIC
low complexity region 302 312 N/A INTRINSIC
low complexity region 343 365 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein that is characterized by an N-terminal coiled-coil region downstream of B-box (BBC) domain, a central fibronectin type III domain, and a C-terminal repeats in splA and RyR (SPRY) domain. The encoded protein associates with a subset of microtubules and may be involved in the stability and organization of microtubules during cytokinesis. [provided by RefSeq, Apr 2009]
Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Crem C A 18: 3,273,459 A245S possibly damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Fsd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Fsd1 APN 17 55993943 critical splice donor site probably null
IGL01023:Fsd1 APN 17 55988245 missense probably damaging 1.00
IGL01382:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01383:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01384:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01386:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01387:Fsd1 APN 17 55996733 missense probably damaging 1.00
IGL01561:Fsd1 APN 17 55995363 missense probably benign
IGL02065:Fsd1 APN 17 55996499 missense probably damaging 1.00
IGL02172:Fsd1 APN 17 55990244 splice site probably benign
IGL02515:Fsd1 APN 17 55996303 missense probably null 1.00
IGL02674:Fsd1 APN 17 55996483 missense probably benign 0.04
IGL03135:Fsd1 APN 17 55990416 splice site probably null
IGL03380:Fsd1 APN 17 55995456 missense probably benign 0.00
Emboldened UTSW 17 55990542 critical splice donor site probably null
1mM(1):Fsd1 UTSW 17 55988199 missense probably benign 0.26
R0201:Fsd1 UTSW 17 55990522 missense probably benign 0.00
R0521:Fsd1 UTSW 17 55991245 missense probably benign
R0718:Fsd1 UTSW 17 55996445 splice site probably null
R1077:Fsd1 UTSW 17 55990542 critical splice donor site probably null
R1519:Fsd1 UTSW 17 55993870 missense probably benign 0.14
R1696:Fsd1 UTSW 17 55988257 critical splice donor site probably null
R1867:Fsd1 UTSW 17 55991254 missense probably benign 0.00
R2173:Fsd1 UTSW 17 55991223 missense possibly damaging 0.64
R3889:Fsd1 UTSW 17 55993893 missense probably benign 0.27
R3950:Fsd1 UTSW 17 55995517 critical splice donor site probably null
R4787:Fsd1 UTSW 17 55996257 missense possibly damaging 0.51
R4912:Fsd1 UTSW 17 55991241 missense possibly damaging 0.71
R4936:Fsd1 UTSW 17 55996452 missense possibly damaging 0.63
R5718:Fsd1 UTSW 17 55990542 critical splice donor site probably benign
R5749:Fsd1 UTSW 17 55995849 splice site probably null
R7077:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7078:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7091:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7092:Fsd1 UTSW 17 55993876 missense probably damaging 1.00
R7173:Fsd1 UTSW 17 55996696 missense possibly damaging 0.47
R7174:Fsd1 UTSW 17 55991356 missense probably benign 0.01
R7474:Fsd1 UTSW 17 55988149 missense possibly damaging 0.93
R7727:Fsd1 UTSW 17 55988150 missense probably benign 0.00
R8113:Fsd1 UTSW 17 55995881 missense probably benign
X0022:Fsd1 UTSW 17 55995464 nonsense probably null
Z1088:Fsd1 UTSW 17 55991203 missense probably damaging 0.98
Z1177:Fsd1 UTSW 17 55996083 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AGAAGGCGAGACTTGGTGTC -3'
(R):5'- TCCCTAGCAGCTAGAGTGAC -3'

Sequencing Primer
(F):5'- ACCTGCTGCTCTTACAGAGGAC -3'
(R):5'- CTAGCAGCTAGAGTGACCAGGTC -3'
Posted On2019-05-15