Mutagenetix > Incidental Mutations

Incidental Mutation 'R7137:Fsd1'

553156

Institutional Source

Beutler Lab

Gene Symbol

Fsd1

Ensembl Gene

ENSMUSG00000011589

Gene Name

fibronectin type 3 and SPRY domain-containing protein

Synonyms

MMRRC Submission

Accession Numbers

Genbank: NM_183178.2; Ensembl: ENSMUST00000011733

Is this an essential gene?

Possibly non essential (E-score: 0.492) question?

Stock #

R7137 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

55986511-55996881 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 55993876 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 245 (R245H)

Ref Sequence

ENSEMBL: ENSMUSP00000011733 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011733] [ENSMUST00000043785]

Predicted Effect

probably damaging
Transcript: ENSMUST00000011733
AA Change: R245H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000011733
Gene: ENSMUSG00000011589
AA Change: R245H

Domain	Start	End	E-Value	Type
BBC	4	130	7.61e-9	SMART
FN3	165	255	2.96e-4	SMART
Pfam:SPRY	355	473	6.3e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000043785

SMART Domains

Protein: ENSMUSP00000038130
Gene: ENSMUSG00000038781

Domain	Start	End	E-Value	Type
PH	20	120	1.22e-3	SMART
SH2	150	239	2.58e-3	SMART
low complexity region	278	297	N/A	INTRINSIC
low complexity region	302	312	N/A	INTRINSIC
low complexity region	343	365	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosome associated protein that is characterized by an N-terminal coiled-coil region downstream of B-box (BBC) domain, a central fibronectin type III domain, and a C-terminal repeats in splA and RyR (SPRY) domain. The encoded protein associates with a subset of microtubules and may be involved in the stability and organization of microtubules during cytokinesis. [provided by RefSeq, Apr 2009]

Allele List at MGI

All alleles(3) : Targeted, other(2) Gene trapped(1)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	C	6: 121,677,985	S1423P	possibly damaging	Het
Acvr1c	A	G	2: 58,283,387		probably null	Het
Adgrf5	A	G	17: 43,450,897	K1161R	probably damaging	Het
Arhgap32	T	G	9: 32,151,936	D80E	probably benign	Het
Aspg	T	C	12: 112,112,198	V30A	possibly damaging	Het
Bcl2a1d	T	C	9: 88,731,478	D81G	probably damaging	Het
Cep170b	T	C	12: 112,735,167	V160A	probably benign	Het
Ces1c	T	C	8: 93,130,842	Y37C	probably benign	Het
Cntnap5a	T	C	1: 116,089,376	L233P	probably damaging	Het
Crem	C	A	18: 3,273,459	A245S	possibly damaging	Het
Cyp2d12	C	T	15: 82,557,821	A280V	probably benign	Het
Dnah2	C	T	11: 69,491,555	G1243D	probably damaging	Het
Emcn	T	G	3: 137,403,991	N131K	probably damaging	Het
Fat3	A	T	9: 15,997,148	D2519E	probably damaging	Het
Fibin	T	A	2: 110,362,656	D47V	probably damaging	Het
Gimap8	C	A	6: 48,650,253	L54I	probably damaging	Het
Gm20481	A	G	17: 34,970,095	Y27C	unknown	Het
Gm21319	A	T	12: 87,773,546	L81Q	possibly damaging	Het
Grin1	T	G	2: 25,313,538	M154L	probably benign	Het
Ighv8-13	A	G	12: 115,765,577	L20P	probably damaging	Het
Insc	G	A	7: 114,811,615	V236I	probably benign	Het
Lrrk1	A	G	7: 66,285,279	F1031L	probably benign	Het
Man2a2	C	A	7: 80,359,751	R785L	probably benign	Het
Mcur1	C	A	13: 43,544,455		probably null	Het
Med12l	A	C	3: 59,258,254	R1464S	probably damaging	Het
Mycbp2	A	T	14: 103,282,679	M767K	possibly damaging	Het
Naalad2	T	C	9: 18,323,487	I762V	probably benign	Het
Nfkbid	A	G	7: 30,426,256	T357A	possibly damaging	Het
Pcdh17	A	G	14: 84,533,549	R1156G	possibly damaging	Het
Pcdhb1	T	C	18: 37,267,392	S799P	possibly damaging	Het
Pde3a	A	T	6: 141,498,746	E1093D	probably benign	Het
Plcg1	T	C	2: 160,753,926	Y572H	possibly damaging	Het
Plxna4	A	G	6: 32,517,264	L139P	probably damaging	Het
Psma1	A	G	7: 114,274,448	Y6H	probably damaging	Het
Psmd2	A	G	16: 20,652,627	E76G	probably benign	Het
Ptk2	G	A	15: 73,221,809	P854S	possibly damaging	Het
Pyy	T	G	11: 102,107,273	D27A	possibly damaging	Het
Slc22a2	A	G	17: 12,584,341	T21A	probably benign	Het
Slc25a2	T	C	18: 37,638,147	I110V	probably benign	Het
Sult1c2	A	C	17: 53,838,394	W85G	probably damaging	Het
Svs1	A	G	6: 48,990,149	Y677C	probably damaging	Het
Syt12	C	T	19: 4,453,950	D218N	probably damaging	Het
Tln1	C	T	4: 43,540,616	V1462M	probably damaging	Het
Tor1aip2	T	A	1: 156,051,976	N33K	possibly damaging	Het
Usp17lb	C	A	7: 104,841,591	W43L	probably benign	Het
Vmn1r76	A	G	7: 11,930,685	Y201H	possibly damaging	Het
Wnk1	C	A	6: 120,038,212		probably benign	Het
Wrnip1	A	G	13: 32,802,749	D171G	probably benign	Het
Zar1	T	A	5: 72,580,816	N81I	probably damaging	Het
Zbtb45	T	C	7: 13,007,156	T392A	probably benign	Het
Zfp445	T	C	9: 122,854,778	E272G	probably damaging	Het

Other mutations in Fsd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00436:Fsd1	APN	17	55993943	critical splice donor site	probably null
IGL01023:Fsd1	APN	17	55988245	missense	probably damaging	1.00
IGL01382:Fsd1	APN	17	55996733	missense	probably damaging	1.00
IGL01383:Fsd1	APN	17	55996733	missense	probably damaging	1.00
IGL01384:Fsd1	APN	17	55996733	missense	probably damaging	1.00
IGL01386:Fsd1	APN	17	55996733	missense	probably damaging	1.00
IGL01387:Fsd1	APN	17	55996733	missense	probably damaging	1.00
IGL01561:Fsd1	APN	17	55995363	missense	probably benign
IGL02065:Fsd1	APN	17	55996499	missense	probably damaging	1.00
IGL02172:Fsd1	APN	17	55990244	splice site	probably benign
IGL02515:Fsd1	APN	17	55996303	missense	probably null	1.00
IGL02674:Fsd1	APN	17	55996483	missense	probably benign	0.04
IGL03135:Fsd1	APN	17	55990416	splice site	probably null
IGL03380:Fsd1	APN	17	55995456	missense	probably benign	0.00
Emboldened	UTSW	17	55990542	critical splice donor site	probably null
1mM(1):Fsd1	UTSW	17	55988199	missense	probably benign	0.26
R0201:Fsd1	UTSW	17	55990522	missense	probably benign	0.00
R0521:Fsd1	UTSW	17	55991245	missense	probably benign
R0718:Fsd1	UTSW	17	55996445	splice site	probably null
R1077:Fsd1	UTSW	17	55990542	critical splice donor site	probably null
R1519:Fsd1	UTSW	17	55993870	missense	probably benign	0.14
R1696:Fsd1	UTSW	17	55988257	critical splice donor site	probably null
R1867:Fsd1	UTSW	17	55991254	missense	probably benign	0.00
R2173:Fsd1	UTSW	17	55991223	missense	possibly damaging	0.64
R3889:Fsd1	UTSW	17	55993893	missense	probably benign	0.27
R3950:Fsd1	UTSW	17	55995517	critical splice donor site	probably null
R4787:Fsd1	UTSW	17	55996257	missense	possibly damaging	0.51
R4912:Fsd1	UTSW	17	55991241	missense	possibly damaging	0.71
R4936:Fsd1	UTSW	17	55996452	missense	possibly damaging	0.63
R5718:Fsd1	UTSW	17	55990542	critical splice donor site	probably benign
R5749:Fsd1	UTSW	17	55995849	splice site	probably null
R7077:Fsd1	UTSW	17	55993876	missense	probably damaging	1.00
R7078:Fsd1	UTSW	17	55993876	missense	probably damaging	1.00
R7091:Fsd1	UTSW	17	55993876	missense	probably damaging	1.00
R7092:Fsd1	UTSW	17	55993876	missense	probably damaging	1.00
R7173:Fsd1	UTSW	17	55996696	missense	possibly damaging	0.47
R7174:Fsd1	UTSW	17	55991356	missense	probably benign	0.01
R7474:Fsd1	UTSW	17	55988149	missense	possibly damaging	0.93
R7727:Fsd1	UTSW	17	55988150	missense	probably benign	0.00
R8113:Fsd1	UTSW	17	55995881	missense	probably benign
X0022:Fsd1	UTSW	17	55995464	nonsense	probably null
Z1088:Fsd1	UTSW	17	55991203	missense	probably damaging	0.98
Z1177:Fsd1	UTSW	17	55996083	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGAAGGCGAGACTTGGTGTC -3'
(R):5'- TCCCTAGCAGCTAGAGTGAC -3'

Sequencing Primer
(F):5'- ACCTGCTGCTCTTACAGAGGAC -3'
(R):5'- CTAGCAGCTAGAGTGACCAGGTC -3'

Posted On

2019-05-15