Incidental Mutation 'R7137:Crem'
ID553157
Institutional Source Beutler Lab
Gene Symbol Crem
Ensembl Gene ENSMUSG00000063889
Gene NamecAMP responsive element modulator
SynonymsICER
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.449) question?
Stock #R7137 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location3266048-3337748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 3273459 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 245 (A245S)
Ref Sequence ENSEMBL: ENSMUSP00000121118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025069] [ENSMUST00000049942] [ENSMUST00000082141] [ENSMUST00000122958] [ENSMUST00000123672] [ENSMUST00000124747] [ENSMUST00000126578] [ENSMUST00000129435] [ENSMUST00000130455] [ENSMUST00000130599] [ENSMUST00000131899] [ENSMUST00000134027] [ENSMUST00000136961] [ENSMUST00000137568] [ENSMUST00000139537] [ENSMUST00000140332] [ENSMUST00000144496] [ENSMUST00000146265] [ENSMUST00000147138] [ENSMUST00000148305] [ENSMUST00000150235] [ENSMUST00000151084] [ENSMUST00000151311] [ENSMUST00000152108] [ENSMUST00000152900] [ENSMUST00000154135] [ENSMUST00000154470] [ENSMUST00000154705] [ENSMUST00000154715] [ENSMUST00000156234] [ENSMUST00000165086]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025069
AA Change: A286S

PolyPhen 2 Score 0.642 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000025069
Gene: ENSMUSG00000063889
AA Change: A286S

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 3.1e-20 PFAM
BRLZ 285 343 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049942
AA Change: A60S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061925
Gene: ENSMUSG00000063889
AA Change: A60S

DomainStartEndE-ValueType
BRLZ 59 117 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000082141
AA Change: A249S

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080780
Gene: ENSMUSG00000063889
AA Change: A249S

DomainStartEndE-ValueType
Pfam:pKID 63 104 2.6e-20 PFAM
BRLZ 248 306 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000122958
AA Change: A245S

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121118
Gene: ENSMUSG00000063889
AA Change: A245S

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 301 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000123672
AA Change: A158S

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120557
Gene: ENSMUSG00000063889
AA Change: A158S

DomainStartEndE-ValueType
Pfam:pKID 47 88 1.5e-20 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000124747
AA Change: A43S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121352
Gene: ENSMUSG00000063889
AA Change: A43S

DomainStartEndE-ValueType
BRLZ 42 100 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000126578
AA Change: A245S

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114780
Gene: ENSMUSG00000063889
AA Change: A245S

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:pKID 59 100 7.8e-21 PFAM
BRLZ 244 302 3.8e-6 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000118649
Gene: ENSMUSG00000063889
AA Change: A271S

DomainStartEndE-ValueType
low complexity region 63 74 N/A INTRINSIC
Pfam:pKID 98 139 3.1e-21 PFAM
BRLZ 271 328 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129435
AA Change: A184S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117438
Gene: ENSMUSG00000063889
AA Change: A184S

DomainStartEndE-ValueType
Pfam:pKID 10 51 5.6e-21 PFAM
BRLZ 183 240 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130455
AA Change: A276S

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000121541
Gene: ENSMUSG00000063889
AA Change: A276S

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.8e-20 PFAM
BRLZ 275 333 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000130599
AA Change: A170S

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115471
Gene: ENSMUSG00000063889
AA Change: A170S

DomainStartEndE-ValueType
Pfam:pKID 47 88 1.6e-20 PFAM
BRLZ 169 226 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131899
AA Change: A225S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119353
Gene: ENSMUSG00000063889
AA Change: A225S

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.2e-20 PFAM
BRLZ 224 282 3.8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134027
Predicted Effect probably damaging
Transcript: ENSMUST00000136961
AA Change: A209S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000115363
Gene: ENSMUSG00000063889
AA Change: A209S

DomainStartEndE-ValueType
Pfam:pKID 35 76 6.5e-21 PFAM
BRLZ 208 265 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000137568
AA Change: A164S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000115336
Gene: ENSMUSG00000063889
AA Change: A164S

DomainStartEndE-ValueType
Pfam:pKID 53 94 1.5e-20 PFAM
BRLZ 163 221 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000139537
AA Change: A36S

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122123
Gene: ENSMUSG00000063889
AA Change: A36S

DomainStartEndE-ValueType
BRLZ 35 93 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000140332
AA Change: A49S

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115423
Gene: ENSMUSG00000063889
AA Change: A49S

DomainStartEndE-ValueType
BRLZ 48 105 2.73e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000144496
AA Change: A221S

PolyPhen 2 Score 0.820 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120349
Gene: ENSMUSG00000063889
AA Change: A221S

DomainStartEndE-ValueType
Pfam:pKID 35 76 6.9e-21 PFAM
BRLZ 220 277 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146265
AA Change: A213S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119638
Gene: ENSMUSG00000063889
AA Change: A213S

DomainStartEndE-ValueType
low complexity region 67 78 N/A INTRINSIC
Pfam:pKID 102 143 2.1e-20 PFAM
BRLZ 212 269 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000147138
AA Change: A61S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114280
Gene: ENSMUSG00000063889
AA Change: A61S

DomainStartEndE-ValueType
BRLZ 60 117 2.73e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148305
Predicted Effect probably damaging
Transcript: ENSMUST00000150235
AA Change: A298S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121233
Gene: ENSMUSG00000063889
AA Change: A298S

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 1.1e-20 PFAM
BRLZ 297 354 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151084
AA Change: A54S

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118578
Gene: ENSMUSG00000063889
AA Change: A54S

DomainStartEndE-ValueType
BRLZ 48 106 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000151311
AA Change: A237S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118267
Gene: ENSMUSG00000063889
AA Change: A237S

DomainStartEndE-ValueType
Pfam:pKID 63 104 7.5e-21 PFAM
BRLZ 236 293 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152108
AA Change: A158S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122241
Gene: ENSMUSG00000063889
AA Change: A158S

DomainStartEndE-ValueType
Pfam:pKID 35 76 4.7e-21 PFAM
BRLZ 157 214 2.73e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152900
AA Change: A239S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123515
Gene: ENSMUSG00000063889
AA Change: A239S

DomainStartEndE-ValueType
Pfam:pKID 53 94 2.4e-20 PFAM
BRLZ 238 296 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154135
AA Change: A186S

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122051
Gene: ENSMUSG00000063889
AA Change: A186S

DomainStartEndE-ValueType
Pfam:pKID 63 104 1.9e-20 PFAM
BRLZ 185 243 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000154470
AA Change: A223S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118128
Gene: ENSMUSG00000063889
AA Change: A223S

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.3e-20 PFAM
BRLZ 222 280 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154705
AA Change: A66S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119194
Gene: ENSMUSG00000063889
AA Change: A66S

DomainStartEndE-ValueType
BRLZ 60 118 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000154715
AA Change: A270S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122179
Gene: ENSMUSG00000063889
AA Change: A270S

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
Pfam:pKID 84 125 8.7e-21 PFAM
BRLZ 269 327 3.8e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000156234
AA Change: A282S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121388
Gene: ENSMUSG00000063889
AA Change: A282S

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
Pfam:pKID 96 137 9.1e-21 PFAM
BRLZ 281 339 3.8e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165086
AA Change: A235S

PolyPhen 2 Score 0.882 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000127353
Gene: ENSMUSG00000063889
AA Change: A235S

DomainStartEndE-ValueType
low complexity region 77 88 N/A INTRINSIC
Pfam:pKID 112 153 2.4e-20 PFAM
BRLZ 234 292 3.8e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a basic-leucine zipper domain-containing protein that localizes to gene promoters, where it binds to the cyclic AMP response element (CRE). Different protein isoforms encoded by this gene may function as either activators or repressors of transcription. Activity of this gene is important in multiple developmental processes, including spermatogenesis. Mutation of this gene causes male infertility. Alternative splicing and promoter usage result in multiple transcript variants for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Homozygotes for targeted mutations exhibit reduced regenerative capacity after partial hepatectomy and reduced cardiac function. Males are sterile due to a block in spermiogenesis associated with a lack of postmeiotic gene expression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T C 6: 121,677,985 S1423P possibly damaging Het
Acvr1c A G 2: 58,283,387 probably null Het
Adgrf5 A G 17: 43,450,897 K1161R probably damaging Het
Arhgap32 T G 9: 32,151,936 D80E probably benign Het
Aspg T C 12: 112,112,198 V30A possibly damaging Het
Bcl2a1d T C 9: 88,731,478 D81G probably damaging Het
Cep170b T C 12: 112,735,167 V160A probably benign Het
Ces1c T C 8: 93,130,842 Y37C probably benign Het
Cntnap5a T C 1: 116,089,376 L233P probably damaging Het
Cyp2d12 C T 15: 82,557,821 A280V probably benign Het
Dnah2 C T 11: 69,491,555 G1243D probably damaging Het
Emcn T G 3: 137,403,991 N131K probably damaging Het
Fat3 A T 9: 15,997,148 D2519E probably damaging Het
Fibin T A 2: 110,362,656 D47V probably damaging Het
Fsd1 G A 17: 55,993,876 R245H probably damaging Het
Gimap8 C A 6: 48,650,253 L54I probably damaging Het
Gm20481 A G 17: 34,970,095 Y27C unknown Het
Gm21319 A T 12: 87,773,546 L81Q possibly damaging Het
Grin1 T G 2: 25,313,538 M154L probably benign Het
Ighv8-13 A G 12: 115,765,577 L20P probably damaging Het
Insc G A 7: 114,811,615 V236I probably benign Het
Lrrk1 A G 7: 66,285,279 F1031L probably benign Het
Man2a2 C A 7: 80,359,751 R785L probably benign Het
Mcur1 C A 13: 43,544,455 probably null Het
Med12l A C 3: 59,258,254 R1464S probably damaging Het
Mycbp2 A T 14: 103,282,679 M767K possibly damaging Het
Naalad2 T C 9: 18,323,487 I762V probably benign Het
Nfkbid A G 7: 30,426,256 T357A possibly damaging Het
Pcdh17 A G 14: 84,533,549 R1156G possibly damaging Het
Pcdhb1 T C 18: 37,267,392 S799P possibly damaging Het
Pde3a A T 6: 141,498,746 E1093D probably benign Het
Plcg1 T C 2: 160,753,926 Y572H possibly damaging Het
Plxna4 A G 6: 32,517,264 L139P probably damaging Het
Psma1 A G 7: 114,274,448 Y6H probably damaging Het
Psmd2 A G 16: 20,652,627 E76G probably benign Het
Ptk2 G A 15: 73,221,809 P854S possibly damaging Het
Pyy T G 11: 102,107,273 D27A possibly damaging Het
Slc22a2 A G 17: 12,584,341 T21A probably benign Het
Slc25a2 T C 18: 37,638,147 I110V probably benign Het
Sult1c2 A C 17: 53,838,394 W85G probably damaging Het
Svs1 A G 6: 48,990,149 Y677C probably damaging Het
Syt12 C T 19: 4,453,950 D218N probably damaging Het
Tln1 C T 4: 43,540,616 V1462M probably damaging Het
Tor1aip2 T A 1: 156,051,976 N33K possibly damaging Het
Usp17lb C A 7: 104,841,591 W43L probably benign Het
Vmn1r76 A G 7: 11,930,685 Y201H possibly damaging Het
Wnk1 C A 6: 120,038,212 probably benign Het
Wrnip1 A G 13: 32,802,749 D171G probably benign Het
Zar1 T A 5: 72,580,816 N81I probably damaging Het
Zbtb45 T C 7: 13,007,156 T392A probably benign Het
Zfp445 T C 9: 122,854,778 E272G probably damaging Het
Other mutations in Crem
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Crem APN 18 3299236 missense probably damaging 1.00
IGL01532:Crem APN 18 3276732 missense probably benign 0.02
IGL02500:Crem APN 18 3273477 missense probably damaging 1.00
IGL03280:Crem APN 18 3273415 splice site probably benign
menthe UTSW 18 3268070 missense probably damaging 1.00
R0379:Crem UTSW 18 3299226 missense probably damaging 1.00
R0987:Crem UTSW 18 3288060 missense probably damaging 0.98
R1829:Crem UTSW 18 3295037 splice site probably null
R1932:Crem UTSW 18 3299284 missense probably benign 0.27
R2086:Crem UTSW 18 3288098 intron probably benign
R2093:Crem UTSW 18 3299256 missense probably damaging 1.00
R4152:Crem UTSW 18 3288055 missense probably damaging 0.99
R4568:Crem UTSW 18 3299175 missense probably damaging 0.98
R4758:Crem UTSW 18 3327527 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6032:Crem UTSW 18 3267673 missense probably damaging 1.00
R6445:Crem UTSW 18 3309671 missense probably benign
R6525:Crem UTSW 18 3268070 missense probably damaging 1.00
R6651:Crem UTSW 18 3325428 missense probably benign 0.18
R7035:Crem UTSW 18 3327503 missense probably damaging 1.00
R7401:Crem UTSW 18 3295329 missense probably damaging 1.00
R7463:Crem UTSW 18 3295094 missense probably benign 0.06
R7516:Crem UTSW 18 3299141 splice site probably null
R8095:Crem UTSW 18 3295106 missense probably benign 0.00
R8146:Crem UTSW 18 3288007 missense possibly damaging 0.68
R8266:Crem UTSW 18 3309535 intron probably benign
R8308:Crem UTSW 18 3295397 missense possibly damaging 0.55
Z1176:Crem UTSW 18 3267730 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGGCAGAGCATAAGCAC -3'
(R):5'- GGGAACAGGCTAGAGTATTTGTAGC -3'

Sequencing Primer
(F):5'- GAGCATAAGCACACACACGAAG -3'
(R):5'- ACAATCTTTACTGACATGTACAAGG -3'
Posted On2019-05-15