Incidental Mutation 'R0600:Nfix'
ID55316
Institutional Source Beutler Lab
Gene Symbol Nfix
Ensembl Gene ENSMUSG00000001911
Gene Namenuclear factor I/X
Synonyms
MMRRC Submission 038789-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.477) question?
Stock #R0600 (G1)
Quality Score139
Status Validated
Chromosome8
Chromosomal Location84699876-84800344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84726526 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 300 (R300C)
Ref Sequence ENSEMBL: ENSMUSP00000115691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076715] [ENSMUST00000098571] [ENSMUST00000099070] [ENSMUST00000109762] [ENSMUST00000109764] [ENSMUST00000126806]
Predicted Effect probably damaging
Transcript: ENSMUST00000076715
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076005
Gene: ENSMUSG00000001911
AA Change: R300C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.1e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 322 7.4e-32 PFAM
Pfam:CTF_NFI 313 396 3.8e-19 PFAM
Predicted Effect silent
Transcript: ENSMUST00000098571
SMART Domains Protein: ENSMUSP00000096170
Gene: ENSMUSG00000074203

DomainStartEndE-ValueType
low complexity region 21 31 N/A INTRINSIC
low complexity region 34 51 N/A INTRINSIC
low complexity region 73 85 N/A INTRINSIC
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099070
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096669
Gene: ENSMUSG00000001911
AA Change: R300C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 4.7e-30 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 437 2.7e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109762
AA Change: R291C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105384
Gene: ENSMUSG00000001911
AA Change: R291C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.1e-27 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 312 5.4e-32 PFAM
Pfam:CTF_NFI 305 387 3.6e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109764
AA Change: R292C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105386
Gene: ENSMUSG00000001911
AA Change: R292C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1e-28 PFAM
DWA 59 167 1.86e-18 SMART
low complexity region 180 191 N/A INTRINSIC
Pfam:CTF_NFI 205 494 9.8e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126806
AA Change: R300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115691
Gene: ENSMUSG00000001911
AA Change: R300C

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 3 46 7.1e-31 PFAM
DWA 67 175 1.86e-18 SMART
low complexity region 188 199 N/A INTRINSIC
Pfam:CTF_NFI 213 488 1.5e-83 PFAM
Meta Mutation Damage Score 0.3011 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.1%
  • 20x: 93.5%
Validation Efficiency 99% (95/96)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor that binds the palindromic sequence 5'-TTGGCNNNNNGCCAA-3 in viral and cellular promoters. The encoded protein can also stimulate adenovirus replication in vitro. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a mutation in this gene display postnatal lethality, hydrocephalus, partial agenesis of the corpus callosum, deformation of the spine due to delayed vertebral body ossification, degeneration of intervertebral disks, decreased mineralization and impaired endochondral ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057M21Rik A G 7: 131,357,660 S150P probably damaging Het
4932431P20Rik T A 7: 29,533,265 noncoding transcript Het
5530400C23Rik T G 6: 133,293,211 probably benign Het
Ahctf1 A C 1: 179,763,468 probably null Het
Ang5 T C 14: 43,962,749 V90A probably benign Het
Ano9 C T 7: 141,104,710 G442R probably damaging Het
Apaf1 G A 10: 91,060,052 T386I probably damaging Het
Apob C A 12: 8,006,440 H1608N probably damaging Het
Arhgap12 C A 18: 6,064,433 probably benign Het
Asxl1 T A 2: 153,399,904 D791E probably benign Het
Avl9 T C 6: 56,736,906 V383A probably benign Het
Btbd1 A C 7: 81,816,006 D197E probably damaging Het
C87499 A T 4: 88,629,299 I45K probably damaging Het
Camta2 T C 11: 70,673,959 I938V possibly damaging Het
Cdca7 C A 2: 72,483,467 A200D possibly damaging Het
Cep104 A T 4: 154,006,792 Y923F possibly damaging Het
Cep135 G C 5: 76,621,305 V601L probably benign Het
Ces2b G A 8: 104,835,910 G291S probably benign Het
Col6a6 C T 9: 105,761,440 G1400D probably damaging Het
Cyth2 T C 7: 45,813,117 E1G probably damaging Het
Dand5 A T 8: 84,816,292 L185Q probably damaging Het
Dck T C 5: 88,781,221 V253A probably benign Het
Ddx20 A G 3: 105,679,080 S650P probably damaging Het
Dicer1 G A 12: 104,706,864 P799S probably damaging Het
Dst C T 1: 34,189,119 P1606L probably damaging Het
Eya2 G A 2: 165,769,237 C477Y probably damaging Het
Fam208b A T 13: 3,576,054 F1299I probably benign Het
Fip1l1 T A 5: 74,595,842 N498K probably damaging Het
Flt4 C T 11: 49,636,339 probably benign Het
Galntl6 T C 8: 57,837,183 probably null Het
Gda A T 19: 21,434,303 F44I possibly damaging Het
Gli2 G A 1: 118,840,389 R703C probably damaging Het
Gm14085 A T 2: 122,514,398 I162F probably damaging Het
Golgb1 T A 16: 36,916,271 L1960Q probably damaging Het
Gramd1b T C 9: 40,308,355 D341G probably damaging Het
Grid2 G T 6: 63,503,435 A78S probably benign Het
Hao2 A T 3: 98,883,560 probably benign Het
Hook3 A G 8: 26,118,986 V10A probably benign Het
Kif20a A G 18: 34,629,209 E425G probably damaging Het
Lrp1 T C 10: 127,567,383 D2107G probably benign Het
Lrriq3 T C 3: 155,187,736 I358T possibly damaging Het
Mad2l2 A G 4: 148,140,924 D17G possibly damaging Het
Mastl G T 2: 23,133,346 T455K probably benign Het
Mkln1 G T 6: 31,432,927 probably benign Het
Mmp1b A T 9: 7,387,947 Y16N possibly damaging Het
Mmp24 C T 2: 155,792,597 A79V probably benign Het
Mrps35 T A 6: 147,070,734 C292S possibly damaging Het
Myom1 T C 17: 71,120,648 F1435L possibly damaging Het
Nars2 C T 7: 97,039,923 H351Y probably damaging Het
Nat2 A T 8: 67,501,267 I10F probably damaging Het
Olfm5 A T 7: 104,153,869 Y462* probably null Het
Olfr1228 C A 2: 89,249,398 E87* probably null Het
Olfr1339 C T 4: 118,734,789 H87Y probably damaging Het
Olfr1508 T C 14: 52,463,509 I167V probably benign Het
Olfr322 C A 11: 58,666,160 F200L probably damaging Het
Olfr340 C A 2: 36,452,648 A21E probably benign Het
Olfr44 A T 9: 39,484,988 F85L probably benign Het
Olfr495 T A 7: 108,395,231 I37N probably damaging Het
Olfr855 T C 9: 19,585,304 S256P possibly damaging Het
Olfr926 T A 9: 38,877,815 I213N probably damaging Het
Otog A T 7: 46,251,395 probably benign Het
Pdcd2l A T 7: 34,192,807 D212E possibly damaging Het
Pex5 T C 6: 124,404,637 N213S probably benign Het
Pkn3 C T 2: 30,081,134 P238S probably benign Het
Prl2b1 A T 13: 27,390,740 probably null Het
Ptprb A T 10: 116,368,807 I1849L possibly damaging Het
Rasal3 G T 17: 32,393,526 S787Y probably damaging Het
Scn2a T A 2: 65,701,833 D596E possibly damaging Het
Sdhd A T 9: 50,603,764 V9D possibly damaging Het
Serinc5 T C 13: 92,708,057 S436P probably damaging Het
Slc27a1 C T 8: 71,584,164 P348L probably damaging Het
Smg1 G A 7: 118,160,383 probably benign Het
Sorl1 A T 9: 42,043,900 probably benign Het
Sprtn T A 8: 124,900,218 H112Q probably damaging Het
Tet2 A G 3: 133,467,602 M1633T probably benign Het
Tet2 T A 3: 133,467,725 D1592V probably benign Het
Tmem68 A T 4: 3,569,667 C8S probably damaging Het
Tnrc6a T A 7: 123,171,816 I943N probably benign Het
Trib2 A T 12: 15,794,068 V191D probably damaging Het
Tsc22d4 T C 5: 137,762,655 S113P probably damaging Het
Ttc21b T C 2: 66,239,570 R250G probably damaging Het
Ubr2 T C 17: 46,967,248 Y721C probably damaging Het
Ubtfl1 A T 9: 18,409,364 I63F probably damaging Het
Ush1c G A 7: 46,224,908 P171S probably benign Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vangl1 A G 3: 102,166,937 Y285H probably damaging Het
Virma A G 4: 11,498,769 D70G probably damaging Het
Vmn2r102 T C 17: 19,678,015 F431L probably benign Het
Wdr17 A G 8: 54,661,495 I662T probably damaging Het
Wisp2 G A 2: 163,825,313 C78Y probably damaging Het
Zfp160 G A 17: 21,027,006 R606H probably benign Het
Zfp369 C T 13: 65,296,434 R464C probably damaging Het
Other mutations in Nfix
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Nfix APN 8 84726477 missense probably damaging 0.99
IGL01919:Nfix APN 8 84726474 missense probably damaging 1.00
IGL01950:Nfix APN 8 84713786 makesense probably null
IGL02862:Nfix APN 8 84713846 missense probably benign 0.07
R0142:Nfix UTSW 8 84721686 missense probably damaging 1.00
R0309:Nfix UTSW 8 84721774 missense probably damaging 1.00
R0622:Nfix UTSW 8 84726482 missense probably damaging 0.99
R0628:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0882:Nfix UTSW 8 84727925 missense probably damaging 1.00
R0893:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0973:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R0975:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1014:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1015:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1162:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1241:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1381:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1513:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1521:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1618:Nfix UTSW 8 84726526 missense probably damaging 1.00
R1865:Nfix UTSW 8 84772275 missense possibly damaging 0.73
R1912:Nfix UTSW 8 84721677 missense probably damaging 1.00
R1974:Nfix UTSW 8 84726526 missense probably damaging 1.00
R2208:Nfix UTSW 8 84716247 frame shift probably null
R2251:Nfix UTSW 8 84716170 missense probably benign 0.03
R2268:Nfix UTSW 8 84716247 frame shift probably null
R2270:Nfix UTSW 8 84716247 frame shift probably null
R2272:Nfix UTSW 8 84727175 missense probably damaging 1.00
R2346:Nfix UTSW 8 84716247 frame shift probably null
R2350:Nfix UTSW 8 84716247 frame shift probably null
R2963:Nfix UTSW 8 84716247 frame shift probably null
R2983:Nfix UTSW 8 84716247 frame shift probably null
R3008:Nfix UTSW 8 84716247 frame shift probably null
R3727:Nfix UTSW 8 84716247 frame shift probably null
R3791:Nfix UTSW 8 84716247 frame shift probably null
R4163:Nfix UTSW 8 84716247 frame shift probably null
R4164:Nfix UTSW 8 84716247 frame shift probably null
R4201:Nfix UTSW 8 84716247 frame shift probably null
R4206:Nfix UTSW 8 84716247 frame shift probably null
R4609:Nfix UTSW 8 84726490 missense probably damaging 1.00
R4801:Nfix UTSW 8 84716247 frame shift probably null
R4802:Nfix UTSW 8 84716247 frame shift probably null
R4914:Nfix UTSW 8 84771829 missense probably benign 0.00
R4915:Nfix UTSW 8 84771829 missense probably benign 0.00
R4916:Nfix UTSW 8 84771829 missense probably benign 0.00
R4918:Nfix UTSW 8 84771829 missense probably benign 0.00
R5013:Nfix UTSW 8 84772084 missense possibly damaging 0.86
R5290:Nfix UTSW 8 84713777 nonsense probably null
R6418:Nfix UTSW 8 84727149 missense probably benign 0.01
R6554:Nfix UTSW 8 84727650 missense possibly damaging 0.93
R6786:Nfix UTSW 8 84727647 missense probably damaging 1.00
T0970:Nfix UTSW 8 84726483 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GATCTATGAAGAAGAGGCCATGCCC -3'
(R):5'- TGGAGATGCTCTGCTCCTAGAACTG -3'

Sequencing Primer
(F):5'- ACTATAGGCTTGGTAGCCGTC -3'
(R):5'- GCTCCTAGAACTGGGGTGC -3'
Posted On2013-07-11