Mutagenetix > Incidental Mutation

Incidental Mutation 'R7138:Acacb'

553185

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7138 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 114207326 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 947 (V947M)

Ref Sequence

ENSEMBL: ENSMUSP00000031583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably benign
Transcript: ENSMUST00000031583
AA Change: V947M

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: V947M

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102582
AA Change: V947M

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: V947M

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3110001I22Rik	T	A	16: 13,677,725	D229E	probably benign	Het
Abca4	T	A	3: 122,105,464	C698*	probably null	Het
Acadsb	T	G	7: 131,441,239	L343R	probably damaging	Het
Adgrf2	C	T	17: 42,710,983	E317K	probably damaging	Het
Agap2	A	G	10: 127,087,285	T663A	unknown	Het
Akap8	A	T	17: 32,316,541	F166L	possibly damaging	Het
Ankrd17	A	T	5: 90,242,977	M2278K	probably benign	Het
Avl9	T	C	6: 56,728,257	S148P	probably damaging	Het
Brf1	T	C	12: 112,970,215	E266G	probably damaging	Het
Cabin1	T	C	10: 75,745,353	K380E	probably damaging	Het
Catsper2	T	C	2: 121,397,063	D542G	possibly damaging	Het
Cbln4	C	A	2: 172,042,175	D42Y	probably damaging	Het
Cd5	C	T	19: 10,720,304	R437Q	probably damaging	Het
Ceacam18	G	C	7: 43,639,282	E152D	possibly damaging	Het
Chd8	A	G	14: 52,214,498	S1347P	possibly damaging	Het
Chodl	T	G	16: 78,941,447	I101R	probably damaging	Het
Clk4	T	G	11: 51,277,932	F377L	probably damaging	Het
Cntnap3	C	T	13: 64,781,725		probably null	Het
Dab2	A	G	15: 6,429,299	S231G	probably benign	Het
Disp2	T	A	2: 118,786,880	H118Q	probably benign	Het
Dnah10	T	C	5: 124,822,945	F3869S	probably damaging	Het
Edil3	C	T	13: 89,131,728	T175I	probably damaging	Het
Fap	A	G	2: 62,542,178	S319P	probably benign	Het
Frmpd2	T	A	14: 33,571,804	V1309E	probably benign	Het
Galntl5	T	A	5: 25,189,844	S70T	probably benign	Het
Gm16368	T	G	12: 88,083,878	I61R	probably damaging	Het
Gm21994	T	C	2: 150,255,452	H47R	probably damaging	Het
Gm5622	G	T	14: 51,655,882	E89*	probably null	Het
Gna15	G	A	10: 81,508,047	T260M	probably damaging	Het
Gucy2c	A	G	6: 136,728,344	I531T	probably damaging	Het
Heatr5b	A	G	17: 78,827,988	V238A	probably damaging	Het
Htr2a	A	G	14: 74,705,742	Y254C	probably damaging	Het
Inpp5b	A	G	4: 124,785,272	R491G	probably damaging	Het
Kcnt2	C	T	1: 140,596,040	L1093F	possibly damaging	Het
Kcp	C	A	6: 29,491,862	E922*	probably null	Het
Lrp2	G	A	2: 69,465,745	A3340V	possibly damaging	Het
Lrrn1	T	G	6: 107,568,375	V378G	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Net1	G	A	13: 3,888,510	R126C	probably damaging	Het
Nipsnap3a	T	C	4: 52,993,978	C20R	probably benign	Het
Nxpe2	C	T	9: 48,320,706	C317Y	probably damaging	Het
Olfr1418	T	A	19: 11,855,288	I222F	probably damaging	Het
Olfr145	T	C	9: 37,898,064	I220T	probably damaging	Het
Olfr648	T	C	7: 104,180,297	Y37C	probably damaging	Het
Olfr969	T	G	9: 39,795,790	Y138*	probably null	Het
Orm1	T	A	4: 63,344,712	W39R	probably damaging	Het
Pds5b	A	T	5: 150,800,677	K1240*	probably null	Het
Pdss1	T	A	2: 22,912,669	H173Q	probably damaging	Het
Pebp1	A	G	5: 117,285,817	W84R	probably damaging	Het
Pla2g16	T	A	19: 7,579,185	V117E	probably damaging	Het
Pla2g4e	C	T	2: 120,171,278	C630Y	probably damaging	Het
Plekho2	G	T	9: 65,556,353	Q405K	probably benign	Het
Plppr2	T	A	9: 21,944,412	V227E	probably damaging	Het
Rapgef4	T	C	2: 72,198,363	S393P	probably damaging	Het
Rapgefl1	A	G	11: 98,847,074		probably null	Het
Ripk3	C	A	14: 55,788,346	R19L	probably benign	Het
Rnase10	G	T	14: 51,009,710	V182F	probably damaging	Het
Rsf1	T	A	7: 97,669,795	S917R		Het
Sephs2	T	C	7: 127,273,015	N302S	possibly damaging	Het
Slc13a2	C	T	11: 78,399,124	V455M	possibly damaging	Het
Slc30a2	A	T	4: 134,344,118	D54V	probably benign	Het
Slco6c1	T	C	1: 97,119,981	E199G	possibly damaging	Het
Snx27	A	T	3: 94,528,940	M256K	probably benign	Het
Spag4	T	A	2: 156,066,599	S150T	probably benign	Het
Spon1	T	A	7: 114,036,710	C720S	probably damaging	Het
Tbc1d22a	T	C	15: 86,239,155	S166P	probably benign	Het
Tbc1d9	T	C	8: 83,210,484	I65T	probably damaging	Het
Tmem176a	T	A	6: 48,844,019	V141D	probably damaging	Het
Tmem268	G	A	4: 63,562,450		probably benign	Het
Tonsl	A	G	15: 76,634,776	V519A	probably benign	Het
Ttn	G	A	2: 76,782,032	P17204S	possibly damaging	Het
Wisp3	T	A	10: 39,158,477	Q43L	possibly damaging	Het
Wrap53	T	A	11: 69,563,868	D225V	probably benign	Het
Zfhx4	G	A	3: 5,412,047	A3241T	possibly damaging	Het
Znfx1	T	C	2: 167,056,777	R76G	probably benign	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R4898:Acacb	UTSW	5	114232938	missense	probably benign	0.04
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TTGTACATGAATGGCGCCCAG -3'
(R):5'- TGTTACATCATCGCCTGAGC -3'

Sequencing Primer
(F):5'- GCTGTCACTGTGATGCAAC -3'
(R):5'- CAGAGCATGTCTGTGAATGATGC -3'

Posted On

2019-05-15