Incidental Mutation 'R7138:Acacb'
ID 553185
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 045249-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7138 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 114345387 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 947 (V947M)
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably benign
Transcript: ENSMUST00000031583
AA Change: V947M

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: V947M

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102582
AA Change: V947M

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: V947M

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,899,113 (GRCm39) C698* probably null Het
Acadsb T G 7: 131,042,968 (GRCm39) L343R probably damaging Het
Adgrf2 C T 17: 43,021,874 (GRCm39) E317K probably damaging Het
Agap2 A G 10: 126,923,154 (GRCm39) T663A unknown Het
Akap8 A T 17: 32,535,515 (GRCm39) F166L possibly damaging Het
Ankrd17 A T 5: 90,390,836 (GRCm39) M2278K probably benign Het
Avl9 T C 6: 56,705,242 (GRCm39) S148P probably damaging Het
Brf1 T C 12: 112,933,835 (GRCm39) E266G probably damaging Het
Cabin1 T C 10: 75,581,187 (GRCm39) K380E probably damaging Het
Catsper2 T C 2: 121,227,544 (GRCm39) D542G possibly damaging Het
Cbln4 C A 2: 171,884,095 (GRCm39) D42Y probably damaging Het
Ccn6 T A 10: 39,034,473 (GRCm39) Q43L possibly damaging Het
Cd5 C T 19: 10,697,668 (GRCm39) R437Q probably damaging Het
Ceacam18 G C 7: 43,288,706 (GRCm39) E152D possibly damaging Het
Chd8 A G 14: 52,451,955 (GRCm39) S1347P possibly damaging Het
Chodl T G 16: 78,738,335 (GRCm39) I101R probably damaging Het
Clk4 T G 11: 51,168,759 (GRCm39) F377L probably damaging Het
Cntnap3 C T 13: 64,929,539 (GRCm39) probably null Het
Dab2 A G 15: 6,458,780 (GRCm39) S231G probably benign Het
Disp2 T A 2: 118,617,361 (GRCm39) H118Q probably benign Het
Dnah10 T C 5: 124,900,009 (GRCm39) F3869S probably damaging Het
Edil3 C T 13: 89,279,847 (GRCm39) T175I probably damaging Het
Eif1ad18 T G 12: 88,050,648 (GRCm39) I61R probably damaging Het
Fap A G 2: 62,372,522 (GRCm39) S319P probably benign Het
Frmpd2 T A 14: 33,293,761 (GRCm39) V1309E probably benign Het
Galntl5 T A 5: 25,394,842 (GRCm39) S70T probably benign Het
Gm5622 G T 14: 51,893,339 (GRCm39) E89* probably null Het
Gna15 G A 10: 81,343,881 (GRCm39) T260M probably damaging Het
Gucy2c A G 6: 136,705,342 (GRCm39) I531T probably damaging Het
Heatr5b A G 17: 79,135,417 (GRCm39) V238A probably damaging Het
Htr2a A G 14: 74,943,182 (GRCm39) Y254C probably damaging Het
Inpp5b A G 4: 124,679,065 (GRCm39) R491G probably damaging Het
Kcnt2 C T 1: 140,523,778 (GRCm39) L1093F possibly damaging Het
Kcp C A 6: 29,491,861 (GRCm39) E922* probably null Het
Lrp2 G A 2: 69,296,089 (GRCm39) A3340V possibly damaging Het
Lrrn1 T G 6: 107,545,336 (GRCm39) V378G probably damaging Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Net1 G A 13: 3,938,510 (GRCm39) R126C probably damaging Het
Nipsnap3a T C 4: 52,993,978 (GRCm39) C20R probably benign Het
Nxpe2 C T 9: 48,232,006 (GRCm39) C317Y probably damaging Het
Or10v9 T A 19: 11,832,652 (GRCm39) I222F probably damaging Het
Or52h1 T C 7: 103,829,504 (GRCm39) Y37C probably damaging Het
Or8b8 T C 9: 37,809,360 (GRCm39) I220T probably damaging Het
Or8g54 T G 9: 39,707,086 (GRCm39) Y138* probably null Het
Orm1 T A 4: 63,262,949 (GRCm39) W39R probably damaging Het
Pds5b A T 5: 150,724,142 (GRCm39) K1240* probably null Het
Pdss1 T A 2: 22,802,681 (GRCm39) H173Q probably damaging Het
Pebp1 A G 5: 117,423,882 (GRCm39) W84R probably damaging Het
Pla2g4e C T 2: 120,001,759 (GRCm39) C630Y probably damaging Het
Plaat3 T A 19: 7,556,550 (GRCm39) V117E probably damaging Het
Plekho2 G T 9: 65,463,635 (GRCm39) Q405K probably benign Het
Plppr2 T A 9: 21,855,708 (GRCm39) V227E probably damaging Het
Pphln1-ps1 T A 16: 13,495,589 (GRCm39) D229E probably benign Het
Rapgef4 T C 2: 72,028,707 (GRCm39) S393P probably damaging Het
Rapgefl1 A G 11: 98,737,900 (GRCm39) probably null Het
Ripk3 C A 14: 56,025,803 (GRCm39) R19L probably benign Het
Rnase10 G T 14: 51,247,167 (GRCm39) V182F probably damaging Het
Rsf1 T A 7: 97,319,002 (GRCm39) S917R Het
Sephs2 T C 7: 126,872,187 (GRCm39) N302S possibly damaging Het
Slc13a2 C T 11: 78,289,950 (GRCm39) V455M possibly damaging Het
Slc30a2 A T 4: 134,071,429 (GRCm39) D54V probably benign Het
Slco6c1 T C 1: 97,047,706 (GRCm39) E199G possibly damaging Het
Snx27 A T 3: 94,436,247 (GRCm39) M256K probably benign Het
Spag4 T A 2: 155,908,519 (GRCm39) S150T probably benign Het
Spon1 T A 7: 113,635,945 (GRCm39) C720S probably damaging Het
Tbc1d22a T C 15: 86,123,356 (GRCm39) S166P probably benign Het
Tbc1d9 T C 8: 83,937,113 (GRCm39) I65T probably damaging Het
Tmem176a T A 6: 48,820,953 (GRCm39) V141D probably damaging Het
Tmem268 G A 4: 63,480,687 (GRCm39) probably benign Het
Tonsl A G 15: 76,518,976 (GRCm39) V519A probably benign Het
Ttn G A 2: 76,612,376 (GRCm39) P17204S possibly damaging Het
Wrap53 T A 11: 69,454,694 (GRCm39) D225V probably benign Het
Zfhx4 G A 3: 5,477,107 (GRCm39) A3241T possibly damaging Het
Zfp1002 T C 2: 150,097,372 (GRCm39) H47R probably damaging Het
Znfx1 T C 2: 166,898,697 (GRCm39) R76G probably benign Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTACATGAATGGCGCCCAG -3'
(R):5'- TGTTACATCATCGCCTGAGC -3'

Sequencing Primer
(F):5'- GCTGTCACTGTGATGCAAC -3'
(R):5'- CAGAGCATGTCTGTGAATGATGC -3'
Posted On 2019-05-15