Incidental Mutation 'R7138:Avl9'
ID553191
Institutional Source Beutler Lab
Gene Symbol Avl9
Ensembl Gene ENSMUSG00000029787
Gene NameAVL9 cell migration associated
SynonymsD730049P16Rik, 5830411G16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R7138 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location56714899-56761912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56728257 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 148 (S148P)
Ref Sequence ENSEMBL: ENSMUSP00000031805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031805] [ENSMUST00000177249] [ENSMUST00000204193]
Predicted Effect probably damaging
Transcript: ENSMUST00000031805
AA Change: S148P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031805
Gene: ENSMUSG00000029787
AA Change: S148P

DomainStartEndE-ValueType
Pfam:Afi1 15 102 3.8e-11 PFAM
Pfam:Avl9 16 521 7.1e-160 PFAM
Pfam:DUF2347 19 175 1.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177249
AA Change: S148P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144696
Gene: ENSMUSG00000029787
AA Change: S148P

DomainStartEndE-ValueType
Pfam:Afi1 15 111 2e-8 PFAM
Pfam:Avl9 16 209 3.9e-86 PFAM
Pfam:DUF2347 19 179 3.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204193
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110001I22Rik T A 16: 13,677,725 D229E probably benign Het
Abca4 T A 3: 122,105,464 C698* probably null Het
Acacb G A 5: 114,207,326 V947M probably benign Het
Acadsb T G 7: 131,441,239 L343R probably damaging Het
Adgrf2 C T 17: 42,710,983 E317K probably damaging Het
Agap2 A G 10: 127,087,285 T663A unknown Het
Akap8 A T 17: 32,316,541 F166L possibly damaging Het
Ankrd17 A T 5: 90,242,977 M2278K probably benign Het
Brf1 T C 12: 112,970,215 E266G probably damaging Het
Cabin1 T C 10: 75,745,353 K380E probably damaging Het
Catsper2 T C 2: 121,397,063 D542G possibly damaging Het
Cbln4 C A 2: 172,042,175 D42Y probably damaging Het
Cd5 C T 19: 10,720,304 R437Q probably damaging Het
Ceacam18 G C 7: 43,639,282 E152D possibly damaging Het
Chd8 A G 14: 52,214,498 S1347P possibly damaging Het
Chodl T G 16: 78,941,447 I101R probably damaging Het
Clk4 T G 11: 51,277,932 F377L probably damaging Het
Cntnap3 C T 13: 64,781,725 probably null Het
Dab2 A G 15: 6,429,299 S231G probably benign Het
Disp2 T A 2: 118,786,880 H118Q probably benign Het
Dnah10 T C 5: 124,822,945 F3869S probably damaging Het
Edil3 C T 13: 89,131,728 T175I probably damaging Het
Fap A G 2: 62,542,178 S319P probably benign Het
Frmpd2 T A 14: 33,571,804 V1309E probably benign Het
Galntl5 T A 5: 25,189,844 S70T probably benign Het
Gm16368 T G 12: 88,083,878 I61R probably damaging Het
Gm21994 T C 2: 150,255,452 H47R probably damaging Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gna15 G A 10: 81,508,047 T260M probably damaging Het
Gucy2c A G 6: 136,728,344 I531T probably damaging Het
Heatr5b A G 17: 78,827,988 V238A probably damaging Het
Htr2a A G 14: 74,705,742 Y254C probably damaging Het
Inpp5b A G 4: 124,785,272 R491G probably damaging Het
Kcnt2 C T 1: 140,596,040 L1093F possibly damaging Het
Kcp C A 6: 29,491,862 E922* probably null Het
Lrp2 G A 2: 69,465,745 A3340V possibly damaging Het
Lrrn1 T G 6: 107,568,375 V378G probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Net1 G A 13: 3,888,510 R126C probably damaging Het
Nipsnap3a T C 4: 52,993,978 C20R probably benign Het
Nxpe2 C T 9: 48,320,706 C317Y probably damaging Het
Olfr1418 T A 19: 11,855,288 I222F probably damaging Het
Olfr145 T C 9: 37,898,064 I220T probably damaging Het
Olfr648 T C 7: 104,180,297 Y37C probably damaging Het
Olfr969 T G 9: 39,795,790 Y138* probably null Het
Orm1 T A 4: 63,344,712 W39R probably damaging Het
Pds5b A T 5: 150,800,677 K1240* probably null Het
Pdss1 T A 2: 22,912,669 H173Q probably damaging Het
Pebp1 A G 5: 117,285,817 W84R probably damaging Het
Pla2g16 T A 19: 7,579,185 V117E probably damaging Het
Pla2g4e C T 2: 120,171,278 C630Y probably damaging Het
Plekho2 G T 9: 65,556,353 Q405K probably benign Het
Plppr2 T A 9: 21,944,412 V227E probably damaging Het
Rapgef4 T C 2: 72,198,363 S393P probably damaging Het
Rapgefl1 A G 11: 98,847,074 probably null Het
Ripk3 C A 14: 55,788,346 R19L probably benign Het
Rnase10 G T 14: 51,009,710 V182F probably damaging Het
Rsf1 T A 7: 97,669,795 S917R Het
Sephs2 T C 7: 127,273,015 N302S possibly damaging Het
Slc13a2 C T 11: 78,399,124 V455M possibly damaging Het
Slc30a2 A T 4: 134,344,118 D54V probably benign Het
Slco6c1 T C 1: 97,119,981 E199G possibly damaging Het
Snx27 A T 3: 94,528,940 M256K probably benign Het
Spag4 T A 2: 156,066,599 S150T probably benign Het
Spon1 T A 7: 114,036,710 C720S probably damaging Het
Tbc1d22a T C 15: 86,239,155 S166P probably benign Het
Tbc1d9 T C 8: 83,210,484 I65T probably damaging Het
Tmem176a T A 6: 48,844,019 V141D probably damaging Het
Tmem268 G A 4: 63,562,450 probably benign Het
Tonsl A G 15: 76,634,776 V519A probably benign Het
Ttn G A 2: 76,782,032 P17204S possibly damaging Het
Wisp3 T A 10: 39,158,477 Q43L possibly damaging Het
Wrap53 T A 11: 69,563,868 D225V probably benign Het
Zfhx4 G A 3: 5,412,047 A3241T possibly damaging Het
Znfx1 T C 2: 167,056,777 R76G probably benign Het
Other mutations in Avl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Avl9 APN 6 56725090 missense probably damaging 1.00
IGL01433:Avl9 APN 6 56753397 missense probably damaging 0.99
IGL02865:Avl9 APN 6 56736873 missense probably damaging 1.00
IGL02932:Avl9 APN 6 56736551 missense probably benign 0.00
Atlanta UTSW 6 56753390 missense possibly damaging 0.54
H8562:Avl9 UTSW 6 56757310 missense probably damaging 1.00
H8786:Avl9 UTSW 6 56757310 missense probably damaging 1.00
R0003:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0029:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0102:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0103:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0122:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0147:Avl9 UTSW 6 56736502 missense probably benign 0.00
R0372:Avl9 UTSW 6 56726324 critical splice donor site probably null
R0446:Avl9 UTSW 6 56736483 missense probably benign 0.00
R0600:Avl9 UTSW 6 56736906 missense probably benign 0.03
R0667:Avl9 UTSW 6 56736483 missense probably benign 0.00
R1560:Avl9 UTSW 6 56725128 nonsense probably null
R1566:Avl9 UTSW 6 56736482 nonsense probably null
R2069:Avl9 UTSW 6 56736435 splice site probably benign
R2362:Avl9 UTSW 6 56736570 missense probably benign 0.07
R2483:Avl9 UTSW 6 56736843 missense probably benign
R2941:Avl9 UTSW 6 56753885 missense probably benign 0.00
R3028:Avl9 UTSW 6 56730687 unclassified probably benign
R3437:Avl9 UTSW 6 56736627 missense probably benign
R3690:Avl9 UTSW 6 56736827 missense probably benign
R3691:Avl9 UTSW 6 56736827 missense probably benign
R3947:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3948:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3949:Avl9 UTSW 6 56728665 critical splice donor site probably null
R3972:Avl9 UTSW 6 56743408 missense probably damaging 1.00
R4734:Avl9 UTSW 6 56736494 missense probably damaging 0.96
R4739:Avl9 UTSW 6 56726309 missense probably damaging 1.00
R5661:Avl9 UTSW 6 56725102 nonsense probably null
R5664:Avl9 UTSW 6 56753839 missense probably damaging 1.00
R6010:Avl9 UTSW 6 56753390 missense possibly damaging 0.54
R6615:Avl9 UTSW 6 56753885 missense probably benign 0.00
R6719:Avl9 UTSW 6 56753385 missense probably damaging 1.00
R8030:Avl9 UTSW 6 56741422 missense probably damaging 0.99
Z1176:Avl9 UTSW 6 56736764 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTTGGGCCCTACAGTTGG -3'
(R):5'- TCACTTTAGCCACTAAACTTCCAG -3'

Sequencing Primer
(F):5'- GGGCCCTACAGTTGGTAGTTAATAAC -3'
(R):5'- GGCCCTCTGTAAGAGCTCTTAAG -3'
Posted On2019-05-15